Wobble hypothesis indicates that: a. fatty acids are degraded 2 carbons at a time. O b. 16S-ribosomal RNA recognizes Shine-Dalgarno sequence of the mRNA and thus initiates protein synthesis. C. DNA replication is semi-conservative. d. the 5'base of anticodons may recognize 1, 2 or 3 bases in the codons and thus only 31 different tRNA molecules can recognize 61 codons. Oe. DNA replication proceeds bidirectionally.

A single RNA molecule with many gene sequences…   a. is only found in eukaryotes   b. is not translated   c. will not have ribosome binding sites   d. is polycistronic RNA   e. is a polysome

One of the concerns with GMO is the toxicity of product by GMO when consumed by humans. Suppose that the product is to block the 16S rRNA in the proakryotic small subunit, do you think it will have a high level of toxicity? Why?   A. Yes, because the genetic code is universal.   B. No, because the genetic code is NEARLY universal.   C. No, because human ribosomes are different.

Which statement is true of the translocation phase of elongation during protein synthesis?   a. The empty tRNA moves to the A site of the ribosomal complex.   b. The empty tRNA moves to the T site of the ribosomal complex.   c. The dipeptide moves from the A site to the P site of the ribosomal complex.   d. The dipeptide moves from the P site to the A site of the ribosomal complex.

A portion of a single strand of DNA is shown below, which contains a amino acid-coding sequence. 5'ACTGCTATGATTGGCTTAGCTGCGTGGACCGTGTCATAGACTGGCT 3' 1. First use this strand as a blueprint to write the Base sequence of a DNA strand that is complementary to this one. 2. Transcribe the complimentary DNA strand that that you made in question 1 into mRNA, and write the mRNA sequence. 3. Finally, use the genetic code dictionary to translate the mRNA that you made in question 2 into the appropriate amino acid sequence.

Which of the following is true about the three major classes of RNAs in the cell: mRNAs, tRNAs, and rRNAs? A. mRNAs encode polypeptide chains. B. tRNAs are structural components of the ribosome. C. rRNAs are adapter molecules that translate the information on an mRNA into a polypeptide sequence. D. mRNAs can also encode tRNAs and rRNAs.

Transcription of protein-coding genes in the eukaryotic nucleus a. produces mature mRNAs. b. is catalyzed by RNA polymerase II. c. is followed by translation in the nucleus. d. happens mostly in condensed heterochromatin. e. is initiated at about 60,000 origins of replication.

Synthesis of new molecules of deoxyribonucleic acid is the process of A. replication B. translation C. transcription  D. ossification  E. cytokinesis