Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired reference-grade quality, particularly in eukaryotic organisms?
Q: Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the…
A: Sequence assembly involves the alignment and merging of fragments from a DNA (deoxyribonucleic acid)…
Q: Why isn’t cDNA synthetic
A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…
Q: Difference between red-labelled and green-labelled cDNA preparations.
A: Difference between red-labelled and green-labelled cDNA preparations.
Q: Why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas…
A: A cDNA (complementary deoxyribonucleic acid) library is a combination of cloned cDNA fragments…
Q: List three independent techniques you could use toidentify DNA sequences encoding human geneswithin…
A: A genome is referred to as genetic material of the organism that composed of DNA or RNA. The genome…
Q: How the amplification of other genomic methods such as optical mapping helps to overcome the…
A: The amplification of other genomic methods like optical mapping has definitely improved the…
Q: Explain why genomic DNA libraries require more coloniesthan are contained by a single genome…
A: A set of cells that together contains an organism’s whole genome that is cut into DNA fragments is…
Q: The exponential nature of PCR allows spectacular increases in the abun- dance of a DNA sequence…
A: PCR (polymerase chain reaction is a technique through which a DNA segment is copied to a million…
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: Why the sequence alignment is extremely important in designing a construct for developing a…
A: Sequence alignment It is defined as the way of arranging the sequences of DNA, RNA or protein to…
Q: Terminal-sequencing reads of clone inserts are a routinepart of genome sequencing. How is the…
A: The whole-genome shotgun (WGS) method used for sequencing the DNA from the pool of many fragments by…
Q: Why is it a large undertaking to construct a DNA library?
A: A deoxyribonucleic acid library could be an assortment of cells that carry cloned items of the whole…
Q: Why a multiple sequence alignment is needed for researchers? What inferences can be derived from…
A: When three or more biological sequences are aligned and studied together, it is referred to as…
Q: Repeated sequences can be classified according to theirorganization in the genome as well as…
A: The heredity or inheritance is defined as the passing of traits from parents to their offspring. The…
Q: In the procedure called RNA sequencing (RNA-Seq), what type ofmolecule is actually sequenced?
A: Ribonucleic acid sequencing (RNA-seq) was developed by Michael Snyder and colleagues in 2008. It is…
Q: What are the two advantages of using sequence analysis of ribosomal components in determining the…
A: Ribosome is an essential component of cellular machinery that is present across all life forms. The…
Q: How the Sequencing Technologies Have Progressed Rapidly ? Explain about this ?
A: Early efforts at sequencing genes ere troublesome, when Gilbert and Maxam reported the sequence of…
Q: Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the…
A: 1.As dd GTP is used, every time it encounters C base it will terminate. 2.When C is encountered with…
Q: Although RNA polymerase is a processive enzyme that remains attached to the DNA over long stretches…
A: RNA polymerase is an enzyme that assists in the transcription process by copying a DNA sequence into…
Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…
A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…
Q: N
A: Recombinant DNA , molecules of DNA from two different species that are inserted into a host organism…
Q: What is the real definition of DNA ligase to make it true
A: In DNA replication, an enzyme called DNA ligase is used during cell division. After the primer is…
Q: Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although…
A: A usual microarray technology includes the hybridization of an mRNA with its original template of…
Q: Briefly explain why RNA-seq gives more information about the transcriptome than does microarray…
A: The RNA transcripts obtained after DNA are converted into RNA by several enzymes by transcription is…
Q: Please answer ASAP RNA sequencing (RNA-Seq) of one sample in one run of a massively parallel…
A: Next-generation sequencing (NGS) is a massively parallel sequencing technology that offers…
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…
A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…
Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…
A: Pyrosequencing is a form of sequencing that works by the principle of DNA replication. The template…
Q: In reversible terminator sequencing, how would the sequencing process be affected if the…
A: The basic between sanger's sequencing and reversible terminator sequencing is that Sangar's based on…
Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…
A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…
Q: Apart from genome size, what factors make completeassembly of a eukaryotic genome more difficult…
A: Chromosomes are thread-like structure, which are composed of nucleic acids and protein. They are…
Q: Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the Eco…
A: The human genome project was started in the year 1990, the main objective of this genome project is;…
Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…
A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…
Q: Traditional Sanger sequencing has largely been replaced in recent years by next-generation and…
A: BASIC INFORMATION Gene Sequencing It is a process through which the arrangement of of the…
Q: Why the concept of a DNA library is still important for a number of modern applications ?
A: A DNA library can be described as the collection of DNA fragments that are kept and propagated in a…
Q: "Whole-Genome Sequencing Is Widely Used for Sequencing and Assembling Entire Genomes". Explain this…
A: Whole genome sequencing It reveals an organism's complete DNA make-up ( allowing us to better…
Q: In large-genome sequencing projects, the initial data usually reveal gaps where no sequence…
A: Primer walking or directed sequencing is a sequencing method for sequencing DNA fragments that are…
Q: HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence…
A: Restriction enzymes are the molecular scissors and are used to cut at a specific site. These are…
Q: Describe several methods commonly used for the sequencing of DNA
A: DNA sequencing refers to the sequencing of the nucleotides base pairs in the genome of an organism.…
Q: Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite…
A: Some of the similarities between microsatellite and minisatellite are that both are type of tandem…
Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…
A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…
Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired reference-grade quality, particularly in eukaryotic organisms?
Step by step
Solved in 2 steps
- Why is Sanger sequencing sometimes referred to as "dye-terminator" sequencing?Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?The following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?
- What is dideoxy sequencing? Explain it please.What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.Apart from genome size, what factors make completeassembly of a eukaryotic genome more difficult than assemblyof a genome from a species of Bacteria or Archaea?
- Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?Is this a sequencing by synthesis method? Explain.Describe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is added or (b) too much ddNTP is added.
- Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisProkaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.Which of the following processes of genetic information flow can occur under lab conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)