Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Why do some genetic mutations lead to completely nonfunctional proteins while others do not affect the functioning of the resulting protein at all?
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- GGGAGTGTATACGGGATGAAGGCATT MRNA: Protein And the phenotype?arrow_forwardA protein was mutated at amino acid position 129. Which of the following mutations will least effect the protein's function? O a) D mutated to R b) D mutated to K O c) D mutated to A d) D mutated to Earrow_forwardIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forward
- would a nonsense mutation at the beginning of the gene, or at the end of the gene, have a greater effect on the shape of the protein produced?arrow_forwardThe structural portion of genes contains two distinct types of regions—exons and introns. Which consists of codons that are eventually translated into the amino acid sequence of a protein, and which consists of codons that are not expressed?arrow_forwardwhat happens if a mutation causes a tRNA to be charged with the wrong amino acid?arrow_forward
- What is translation?arrow_forwardWhat characteristic of the genetic code explains why a substitution mutation in a codon contained within a protein coding gene does not always result in a replacement of one amino acid for another?arrow_forwardHow many base-pairs would have to be deleted in a mutational event to eliminate a single amino acid from a protein and not change the rest of the protein? You must enter a whole number (no text)arrow_forward
- What general structural feature is shared by proteins that specifically form homodimers (but not homotrimers, homoteramers etc)? Only one answer is correct. the surface consists of hydrophilic alpha-helix. the surface is highly modified by post-translational modification. the surface is permanently bound by chaperones. the surface is unstructured. the surface, or part of it, is self-complementary.arrow_forwardA mutation leads to a change in one amino acid in a protein. The result is that the protein no longer functions properly. How is this possible?arrow_forwardWhich type of mutation results in abnormal amino acid sequence?arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education