While proteins are being processed how and where does this occur?

What are the four types of protein modification and their descriptions

What are some examples of post-translational protein processing?

Is it reasonable to expect that protein degradation can take place at any location in a cell?

Why do some genetic mutations lead to completely nonfunctional proteins while others do not affect the functioning of the resulting protein at all?

what is post-translational protein covalent modification? give three examples and name the enzyme that catalyzes each reaction.

On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.

(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…

GGGAGTGTATACGGGATGAAGGCATT MRNA: Protein And the phenotype?

Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.