which region (ribose or base) could be modified to create an inhibitor ?

Q: Incorporating foreign DNA into the existing DNA of an organism will produce a different protein…

A: Recombinant DNA technology alters the genetic material by inserting parts of DNA from various…

Q: saq A certain DNA sample is found to have a makeup consisting of 29% cytosine. Use Chargaff’s rules…

A: Chargaff's rule is a consequence of base pairing. The rule was published in 1950 by the…

Q: Chaperones are: please explain the answer  a.proteins that promote proper amino acid incorporation…

A: Proteins are a class of complex nitrogenous organic compounds, composed of amino acid residues…

Q: Is it reasonable to expect that protein degradation can take place at any location in a cell?

A: Protein degradation is considered as the most important step in the cell, during which proteins are…

Q: In DNA purification, which step facilitates the separation of DNA from RNA? Also, what is the…

A: We have to learn how to clean DNA and split it from RNA. The question is asking which part of the…

Q: Why protein is mutated?

A: Proteins are the building blocks of the cell. They are polypeptides made up of monomeric unit amino…

Q: Which amino acid is predominantly used to add an NH2 moiety during the de novo biosynthesis of…

A: Denovo synthesis of Nucleotides referes to the process of Synthesis of nucleotides from simple…

Q: In an experiment of egg white and calamansi juice in protein denaturation, what will happen?

A: Proteins are one of the  most important metabolites in living organisms, which is almost present in…

Q: Is the product SARDINES is affected by protein denaturation during processing and storage? If so, is…

A: Protein denaturation is a concern in fisheries products. As a result, additional verification tests…

Q: List the 4 types of protein modification and describe each in 1 sentence

A: Protein modification refer to any change in the chemical composition of proteins following…

Q: Some mutations affect changes in protein structure and function that can result in disease whereas…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: What are the names that we use to distinguish between the two strands of DNA with regards to the…

A: DNA is a double helical structure which had two strands that run in Antiparallel direction.  This…

Q: The role of iodine in the Carruthers/Letsinger method of solid-phase DNA synthesis is to act as…

A: Letsinger in 1960's targeted oligonucleotide synthesis using solid phase chemistry. Solid phase…

Q: Describe the process by which pyrimidine nucleotides are produced.

A: A Pyrimidines and purines are two types of nitrogenous bases present in nucleotides. Pyrimidines,…

Q: Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

A: DNA stands for deoxyribonucleic acid. It stores the genetic information in form of nucleotides.

Q: Where is ribonuclease found?

A: Enzymes are the proteinaceus substances which are capable of catalysing chemical reactions of…

Q: Why are single-stranded binding (SSB) proteins required?

A: SSBs are nucleoproteins that can be found in bacteria, bacteria, and animals. When opposed to…

Q: What makes RNA a ribozyme? Why are DNA enzymes absent?

A: Enzymes are biomolecules which can catalyze the biochemical reactions. These can be proteins, RNA or…

Q: What is meant by the binding problem, and what is necessary for binding to occur?

A: "The Binding Problem" is one of the most well-known open questions in computational neuroscience.…

Q: Describe how pyrimidine nucleotides are synthesized

A: The nitrogenous bases found in nucleotides are classified as pyrimidines or purines. Pyrimidines are…

Q: How can you still get a functional protein from frameshift mutation?

A: A mutation is a change in a person's genetic code. Changes as small as the replacement of a single…

Q: Why do acentric fragments get lost?

A: Introduction :- A chromosomal segment with no centromere is known as an acentric fragment.Acentric…

Q: For a protein-DNA binding reaction with ΔH = 0, sketch the van’t Hoff plot, label both axes.

A: Van't hoff equation gives the relationship between equilibrium constant, temperature, and enthalpy…

Q: What exactly is a ribozyme? Can you please give me some real-world examples and explain what makes…

A: A ribozyme is an RNA enzyme that catalyzes biochemical reactions and is capable of specific…

Q: Based on the diagram, what can you conclude about how the chloramphenicol behaves as an antibiotic?

A: Chloramphenicol is a broad-spectrum antibiotic whose spectrum includes several gram-positive and…

Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…

Q: Define the following terms: a. PABP b. lipophilic modification c. methylation d. Kozak sequence e.…

A: mRNA in eukaryotes have polyA tails, which are bound by several regulatory proteins. Proteins in…

Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?

A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: "One gene makes one RNA makes one protein". Is this true? Explain.

A: The "one gene makes one RNA makes one protein" dogma simplifies how genes are expressed. In general,…

Q: how many polypeptide chain is the product of translation?

A: Amino acids are the building blocks of proteins, and each amino acid has a specific structure. The…

Q: Shown below is an internal fragment of a polypeptide. If this polypeptide were growing, onto which…

A: The incorporation of an amino acid into a protein follow specific trend with respect to the ends of…

Q: Draw a mechanism to account for the inter-strand cross linkage of two guanines by busulfan. Explain…

A: DNA is the fundamental hereditary molecule in almost all living organisms, carrying the genetic…