Which of the following mobile genetic elements is a retrotransposon, making up about 10% of the human genome, but no longer codes for a functional gene product (and is therefore a “pseudogene”)? the LINE-1 element (repeated up to 50,000 times in the human genome) the DNA-only transposons known as “jumping genes” (in corn) the avocado sunblotch viroid the typical transposon found in a bacterial chromosome the Alu sequence (repeated up to 1,000,000 times in the human genome)

Q: Which of the following is a transition mutation? OG --> T G --> A G --> C

A:

Q: . In examining Figure 3-19, what do you think is the mainreason for the difference in size of yeast…

A: To find: The main reason for the difference in the size of yeast and human mtDNA.

Q: It is possible to take the DNA of a gene from any source and place it on a chromosome in the nucleus…

A: Recombinant DNA technology is the process in which the recombination of genetic material takes place…

Q: Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of…

A: Genetic Disorders are disease conditions in the body that occur as a result of gene mutations or…

Q: Transgenic mice would be expected to have all of the following characteristics EXCEPT: Contain the…

A: A transgenic animal is an animal that expresses an exogenous gene. Transgenic animals are used for…

Q: Mutations that eliminate the function of a protein are generally associated with:     missense…

A: According to guidelines we have to answer first question only. please kindly post the remaining…

Q: The data below illustrates the role of MutS, MutH and Dam in DNA repair. Strains of E coli that are…

A: Answer .) :- MutS and MutH are two proteins involved in the DNA mismatch repair (MMR) pathway in E.…

Q: What is the most likely method by which a gene produces red eyes in fruit flies?

A: Answer is C.  Mutation changes the coding sequence of the genes so that it codes for red protein…

Q: Basic pRotein coding gene steucture: TF'S ENA-Pol TSS genomic DNA PROmoteRlexon ATG intreon exon…

A: By the process of transcription mRNA is produced from the DNA. This process occurs within the…

Q: A scientist observing a cell during gene expression would be able to easily distinguish it as a…

A: Answer-- option 1-  0 The genotype of II-5 will be ww.

Q: What is a transgene

A:

Q: There are five major types of histones in eukaryotic cells. One of these is not part of the…

A: The nucleosome is the fundamental subunit of chromatin. The nucleosome is composed of two turns of…

Q: The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity…

A: Genetic disease is caused due to mutation in the gene that may result in malfunction of the gene…

Q: The zebra danios are a new type of pet fish, marketed as Glo-Fish. The fish were produced by…

A: Glo-Fish is a new type of pet fish that has been produced by the process of genetic engineering.…

Q: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA fragment A is the 4th…

A: As per our company guidelines, we are supposed to answer only first 3 sub-parts. Kindly repost the…

Q: A large molecule of DNA containing genes essential for the survival of an organism is called a/an…

A: DNA It is defined as the molecule that constitutes two polynucleotide chains, forming a double helix…

Q: Histones are: Group of answer choices Are present in eukaryotic, but not prokaryotic chromosomes…

A: Introduction: In the packaging of DNA into the cell, the histones play a critical role. They order…

Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…

A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…

Q: If the transposable element in Figure 15-14 were a DNAtransposon that had an intron in its…

A: Transposable elements are segments of DNA sequences that transpose or move from one site to another…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.