Which of the following is not a proposed hypothesis for why primate brains are larger, relative to overall size? Trichromatic vision relies on complex cognitive function, as facilitated by increased surface area of the brain A larger brain facilitates more complex social interaction within large groups Finding and processing fruits uses more cognitive function than relying on a leaf-based diet

Q: What is a cross-bridge cycle?

A: The muscles in the body helps in movement of the body. The muscles inside the body works by…

Q: What is the Holliday Model?

A: Genetic recombination is a process by which pieces of DNA are broken and recombined to produce new…

Q: What can Kd values be used for?

A: Kd value is the dissociation constant between any tow interacting molecules. It can be measured in…

Q: Two of the body’s important fluid compartments are those of the interstitial fluid and plasma. How…

A: The liver produces and secretes major plasma proteins, factors in homeostasis and fibrinolysis…

Q: What is the expansion of AAID?

A: Professional organizations are associations that aim to develop a particular profession, and the…

Q: What is triticale  ?

A: Hybrid plants are produced when plant breeders intentionally cross-pollinate the two different…

Q: What are the differences in terms of structure and ligand-binding interactions? What are the…

A: GPCRs are a type of transmembrane receptor that consists of seven transmembrane helices that…

Q: What is the effect of adding isotonic NaCl to the body?

A: Introduction: The cells, tissues, organs, and organ system are interlinked and live together in a…

Q: Define summation, and describe the two types of summation that can occur in the initial segment.

A: Sometimes a single EPSP is strong enough to induce an action potential in the postsynaptic neuron,…

Q: Rigor mortis is usually complete within 1 to 2 days after death (depending onenvironmental…

A: Introduction: When muscle fibers are completely depleted of adenosine triphosphate (ATP) and…

Q: What effect does physostigmine have on smooth muscle contraction? a) no effect on the smooth muscle…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is C (stimulates smooth muscle contraction).

Q: What is the difference and similarities between CPT and HCPCS?

A: Note- This is not a nursing question and should not be posted under the nursing category. Current…

Q: Make specific reference to the Nernst equation but there is no need to cite or calculate any…

A: This question pertains to the topic of electrolyte balance in the body, specifically potassium (K+)…

Q: What specifically causes the release of renin?

A: Renin is an aspartic protease secreted by the kidney regulating mean arterial pressure and…

Q: What is calcitonin/ calcitonin gene-related peptide (CT/CGRP) ?

A: The genes are the hereditary unit of an organism. Expression of the genes produces the phenotypic…

Q: What stores CA+ in the muscle cells and what stores CA+ as a reservoir in the human body?

A: Numerous ion channel proteins pumps are located within the SR membrane and it helps to pump calcium…

Q: Skeletal muscle is visually distinctive (viewed in longitudinal section) in that it appears as long,…

A: In this answer, I will describe the appearance of striations in skeletal muscle fibers when viewed…

Q: After doing some tests, the patients velocity constant is found to be 0.03 hour^-1. The doctor plans…

A: The velocity constant (k) for the patient is 0.03 hour-1. First of all, the infusion rate should be…

Q: What is a gamma rhythm?

A: Introduction: Neural oscillations are variations of rhythmic or repetitive neural activity in the…

Q: Define iodide pump.

A: Iodide pump : An integral membrane protein that co transports Na+ and I- into the thyroid follicles.…

Q: Choose the five correct labels for the figure Enzyme Active site Substrate binds at the enzyme…

A: Introduction Enzyme is a biocatalyst. Enzyme binds with the substrate to form enzyme substrate…

Q: What are cardiac glycosides? How do cardiac glycosides function?

A: Glycosides are biomolecules in which sugar is bound to other functional group through glycosidic…

Q: Explain the limitations of the following expressions: (a) DS = C ln(Tf /Ti), (b) DG = DH − TDS, and…

A: (a) DS C ln(Tf /Ti)The above equation represents a relationship in thermodynamics and is related to…

Q: A muscle is attempting to avoid being eaten by a starfish by tightly closing its shell. Is this an…

A: Introduction Muscle tone is the amount of tension in the skeletal muscles at rest, and it helps to…

Q: What is calmodulin?

A: Introduction: Smooth muscle cells are tiny and spindle-shaped, with varying diameters. They have a…

Q: An individual "step" by a myosin head in one cycle pulls the thin filament about 15 nm. How many…

A: To find the number of steps each actin filament/fibre must make in one contraction, you need the…

Q: A 48-year-old man has hepatic cancer that is unresponsive to standard therapy. He enrolls in a…

A: The objective of the question is to identify the most likely cause of muscle weakness in a patient…

Q: Which of these is not a component of phosphatidylcholine?  a)  glycerol   b)  phosphate  c)  choline…

A: The objective of the question is to identify the component that is not part of the structure of…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: After strenuous exercise, you may notice that your muscles burn and feel sore the next day. Which…

A: Lactic acid is produced by muscle cells to provide energy during strenuous exercise. When the body…

Q: 6. (squiggly pink line), 7. (gray structure) 8. (structure) 9. (entire area in circle)

A: The contraction and relaxation of skeletal muscle fibers are governed by the generation of action…

Q: Question 1: Define the following: (a) Exocrine gland (b) Endocrine gland (c) Hormone

A: There are two major glands in the body the exocrine gland and endocrine gland. The exocrine gland…

Q: Define agonist.

A: Introduction: The muscles are the soft tissues that are present in the majority of mammals. The…

Primate evolution

Primates are a relatively new species and first appeared in the fossil record nearly 55 million years ago. They may have originated as far back as the cretaceous period. Their fossils were observed in North America, Asia, and Europe. Long before the first monkeys and their prosimian relatives developed, most animal species thrived and died. The first primates did not exist until about 50-55 million years ago, even though the planet is 4.54 billion years old and the first life goes back at least 3.5 billion years. Dinosaurs had been extinct for 10 to 15 million years when this happened.