Which of the following is most influenced by the SRY gene?

How does one determine the “regulatory architecture” of individual genes and of the entire genome?

1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50

Briefly explain the regulatory interactions between these three classes of patterning genes (gap, pair rule, segment polarity).  What is the temporal order of action and how do the different classes of genes regulate each other?

Why Some hypermorphic alleles encode overactiveproteins?

There are a small number of genes in which the maternal or paternal copy that an organism inherits is methylated. In one case in mice there are known mutations in the gene. If a mouse inherits a mutated gene from its mother, the mouse is normal. However, if the mouse inherits a mutated gene from its father, the mouse is much smaller than normal. Based on this information which allele is normally methylated, the paternal allele or the maternal allele? Explain your reasoning.

(Grade 12 Genetics) #1  UUU CCU AGU GGU #2  UUC CCA AGC GGC #3  UUC CCG AGA GGA Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two. Explain how this might happen.

What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3

What does the ob gene code for in mice? How does it work? Is this a gene found only in animals, or do humans have it also?