Answered: Which line of code reserves space in…

Engineering

Computer Science

Which line of code reserves space in memory and which line puts a value into memory? LINE 1: int x; LINE 2: x = 1;

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: A value that cannot be changed during the processing of all the instructions in a solution is known…

A: variable :- A value that can be change during the processing of all the instructions in a solution…

Q: Given an array A of size N. write five functions that do the following: 1. Get the value of the…

A: Start Enter the size of the array in N Enter the elements in the array A Call the functions for:…

Q: Assignment Write a program that tracks how much book pages the user reads in total in a day and…

A: Algorithm of the code:- 1. Start 2. Initialize the variables as per the requirements. 3. use a while…

Q: c++ How do you declare a pointer that will hold an integer type?. Multiple choice. int *p; int…

A: To declare a pointer that will hold an integer type: To store the memory address of another…

Q: Programming Language: C++ Create a variable val with value 6. Using a pointer variable, display the…

A: The question has been answered in step2

Q: The range of a set of values is the difference between the highest value and the lowest value in the…

A: Introduction of Program This C++ program takes the size of the array from the user then the user…

Q: Filename: Lab_exer19 Write a program that will read an integer value and will display the…

A: PROGRAM CODE: #include <stdio.h>int main() { int n, i; printf("Enter a number : ");…

Q: You can dereference a smart pointer with the * operator. O True False

A: - We need to verify if we can dereference a smart pointer with a * operator.

Q: Usage: mortgagepmt [-s] -r rate [-d downpayment] price In this assignment, you are asked to do a…

A: Hello student

Q: + Exer

A: Note:- Answering the first 3 sub-parts as per the Guidelines: Errors are defined here: 48) The…

Q: Where do you initialize a static data field?

A: Given: Where do you initialize a static data field?

Q: When working with an array, what can cause an off-by-one error to occur?

A: Solution: Off-by-one error to occur: Problem: Suppose, if we have array with 5 elements. array =…

Q: C++: Describe how the following call by reference works. Make a comment for each line. void…

A: Call by Reference: Original value is changed in call by reference, since we transfer reference…

Q: Use Arrays to create a Java Program that takes in from the user the grades of a student (until…

A: The program is below implemented in java:

Q: z = int('10') what is the value of z?

A: Answer:z = int('10') Now the value of z is in x = 10;

Q: named boston pass. This program will tell the user whether they passed a course or not. Please read…

A: I have written the code below:

Q: Python Programming - Creating DataFrame (Assignment Details) Introduction: In this assignment…

A: PSEUDO CODE: Step 1: Import the “pandas” library to use the data frame object. Step 2: Getting input…

Q: This program prompts a person for income and expense amounts, then calculates their net monthly…

A: Introduction Java class: Class is a blueprint or template used to create objects in Java. It defines…

Q: Describe Operations on Pointer Variables.

A: The pointer variable works with the memory location, all the data access, and stored directly into…

Q: // Add to this partially built code // fill in code where there is a TODO #include using namespace…

A: Add data type char for variables destination and typeOfDay. Define bool variable isDayTime and…

Q: Days Out Write a program that calculates the average number of days a company's employees are…

A: In this question we have to write a Java Program for the Days Out probelm statement Let's code and…

Q: Given the following code: long int data[] - {5, 7, 9, 1}; long int ptr - nullptr; Write a statement…

A: 2

Q: The following function has errors. Locate as many errors as you can. void area(int length = 30, int…

A: Correction Explanation: The argument length should be declared inside the function body or at the…

Q: Problem Statement Working with a static array: Write a program that prompts a user to fill in each…

A: Below is the complete solution with explanation in detail for the given question about static arrays…

Q: What is sent into the parameter variable when an array is supplied as an argument?

A: Intro The answer of the above question is when we pass an array as an argument, a reference to the…

Q: 2- In C++ language, every line of code must end with a semicolon. (True or False).

A: As per our company guidelines we are suppose to answer only one question. Kindly repost other…

Q: Programming Language: C++ Please use the resources included and provide notes for understanding.…

A: SOURCE CODE: #include <iostream>#include <fstream>#include <string>#include…

Q: Write a statement that declares a pointer named 'qptr'. The pointer will be used to store the…

A: Write a statement that declares a pointer named aptr'. The pointer will be used to store the address…

Q: my_round(number, integer): Based on the built-in round(...) function. Takes an integer or float and…

A: def my_round(number,integer): x = round(number,integer) return x print(my_round(1234.5678,-2))…

Q: Construct a flowchart for Base Conversion Module to illustrate the execution flow of the process. In…

A: 1.Start 2. write function DecimalToOctal(). In this function declare required variables and array…

Q: 1- Define an array of 10 components. 2- Initialize all components to zero. 3- Use suitable…

A: There are many languages which are used in today's wold. Computer language can be described as a…

Q: Variables can be passed to a function by. Select one: a.reference b.all (pointer, value, and…

A: Answer :-- B) all(pointer,Value, and reference)

Q: python: numpy def purchases(transactions): """ QUESTION 7 - A high-end store is trying…

A: Define a function "purchases" that takes in a numpy array "transactions" as input. Use np.where() to…

Q: Which aggregating operations are permitted for struct variables but not array variables, and which…

A: What is programming: Programming is the process of designing, writing, testing, and maintaining…

Concept explainers

Concept of memory addresses in pointers

The concept of pointers in high-level languages was introduced in C programming. Pointers are simply the variables that are used to store memory addresses of another variable. These special variables are generally used in the languages such as C Programming and C++ Programming, where it allows the programmer to work more deeply with memory and its addresses.

Question

Which line of code reserves space in memory and which line puts a value into memory?
LINE 1: int x;
LINE 2: x = 1;

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

POINTERS-DYNAMIC ARRAY- EXCEPTION HANDLING POINTERS: GRADE ELIMINATION. A program that will input 10 score for quizzes (0-100) .Get the lowest quiz and eliminate the lowest quiz and compute and output the average of the 9 remaining quizzes. Finally, output only the SUM, LOWEST GRADE and the AVERAGE. DYNAMIC ARRAY & EXCEPTION HANDLING: COMPUTE FOR MILES PER GALLON Make a program that will calculate and compute for the quotient of miles and gallons (mpg: miles per gallons). Your program should must ask the user to specify the size of the array (using dynamic array) for the following variable: miles ,gallons and mpg. Prompt the user to Initialize the value of miles (value for miles should be 100-250) and gallons (values should be from 5-25). Use pointer galPtr for gallons, milPtr for miles and mpgPtr for mpg. Use function MilesPerrGallon (double,double) to compute for the values of mpg and use exception handling try-throw-catch to validate the values of miles and gallons.…
Topic: Array covered in Chapter 7 Do not use any topic not covered in lecture. Write a C++ program to store and process an integer array. The program creates an array (numbers) of integers that can store up to 10 numbers. The program then asks the user to enter up to a maximum of 10 numbers, or enter 999 if there are less than 10 numbers. The program should store the numbers in the array. Then the program goes through the array to display all even (divisible by 2) numbers in the array that are entered by the user. Then the program goes through the array to display all odd (not divisible by 2) numbers in the array that are entered by the user. At the end, the program displays the total sum of all numbers that are entered by the user.
Can arrays be used as a return value?
Upper, Dis-upper Code in C language
Define the term " pass by value " .
c++
C++ language Write a program that asks a user to input 10 numbers. The numbers are stored in the array if itis not Odd and not already available. After creating the array, it asks the user to enter a numberand deletes it from the array.
language c++
Problem Description - JAVA PROGRAMMING Use a Two-dimensional (3x3) array to solve the following problem: Write an application that inputs nine numbers, each of which is between 1 and 10, inclusive. Display the array after the user inputs each value. Rotate/flip the array by changing places. Make the rows columns and vice versa. You have to move the elements to their new locations. Remember to validate the input and display an error message if the user inputs invalid data. Documentation and the screenshot(s) of the results. Example: 1 2 3 4 5 6 7 8 9 the result will be : 1 4 7 2 5 8 3 6 9
Create a Console application that does the following:This program must use a single array to store integers and find the minimum value.1. Create an array that can hold up to 100 integers.2. Prompt the user for the number of integers to be stored in the array.3. Prompt the user for the integers to be stored in the array.4. Use a loop to iterate through the array and determine the minimum value.
ck 72: Use #ifndef QQQ to Identify Temporary CodeThe Problem: Sometimes you just need to keep adding diagnostics to thecode until you find the problem. Of course you don't want these temporaryhacks showing in production code so it would be nice if you could remove themquickly
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…