Which line of code reserves space in memory and which line puts a value into memory? LINE 1: int x; LINE 2: x = 1;

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

Create a Console application that does the following:This program must use a single array to store integers and find the maximum value.1. Create an array and initialize it internally with the values 5, 8, 9, 4, and 2.2. Use a loop to iterate through the array and determine the maximum value.

C++ Array Expander -Just do everything in main and make sure you comment each step  Use Pointer Notation for the function and within the function. Use a main function and return the pointer from the ArrayExpander function to main

//write code that loops through the two variables returns an array ['2 is zwei', '3 is drei', '4 is vier', '5 is fünf', '6 is sechs']// example:// return: ['2 is zwei', '3 is drei', '4 is vier', '5 is fünf', '6 is sechs']// hint: use Array.forEach, Array.map or a for loopfunction germanNumbers(){    const cardinalNumbers = [2,3,4,5,6];    const germanNumbers = ['zwei', 'drei', 'vier', 'fünf', 'sechs']; } // write code that returns an array of ONLY prime numbers that are in the array numbers// example: // return [2, 3, 5, 7, 11, 13]// hint use: Array.filterfunction returnPrimeNumbers(){    const numbers = [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15]; }

Chrome Capture 767x397 Create a python program called code.py. Write a function named pi_multiples() that takes an integer parameter num. This function repeatedly asks the user to enter an integer between 2 and 50. Assume the user will always enter an integer, but if the number is outside this range, the loop must end. So, for any integer x entered within the range, your function must do the following; if x is divisible by num (the parameter), it must multiply x by the value of pi (call it result) and maintain a sum of these results. In every iteration of the loop your function must print x and the result. And when the loop terminates your function should return the sum. To test your function, call pi_multiples() function using any integer number of your choice (for num) and print the returned value. Hint: to use the pi value do the following import math and use math.pi for the value of pi. frames: 0 0/ 10 secs Zip your file, name it code.zip, and submit it using the link available in…

Course: Assembly Language: You have to write the code with proper instructions of Question and send the error free . Dont copy paste from any website create by expert with proper question conditions: Question:                     Write a program that prompts the user to enter two numbers in the form of characters between (0-9). Assume first number is greater than second number. Convert the number in characters to numbers in digits and subtract them. The display the answer after converting it into number character with proper message. Out put should must be like sample. Sample program output is given below: Enter the first number: 5 Enter the second number: 3 The result of subtraction : 2

C++ Vector iteration: Sum of excess.   Vector testGrades contains NUM_VALS test scores. Write a for loop that sets sumExtra to the total extra credit received. Full credit is 100, so anything over 100 is extra credit. Ex: If testGrades = {101, 83, 107, 90}, then sumExtra = 8, because 1 + 0 + 7 + 0 is 8.