Which choice besi describes the location of the majority of the musculo-skeletal system? A. It is in the dorsal cavity B. It is in the ventral cavity C. It is in the abdomino-pelvic cavity D. It is not located in a body cavity

Which choice besi describes the location of the majority of the musculo-skeletal system? A. It is in the dorsal cavity B. It is in the ventral cavity C. It is in the abdomino-pelvic cavity D. It is not located in a body cavity

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter3: Meat And Bones

Section: Chapter Questions

Problem 13FITB

See similar textbooks

Related questions

Q: Please Give a clear explanation handwritten answer.

Q: Q.4. Explain why excessive dosage and abusive usage of drugs such as amphetamines, LSD and…

A: The following are some of its negative effects:

Q: Which of the following is true about neglected tropical diseases? Group of answer choices Though…

A: * Neglected Trophical disesase commonly seen in countries like Africa and Asia and Latin America…

Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…

A: The three point test cross data is given in the question. The three genes are involved in a three…

Q: How can a mutation be beneficial?

A: Mutations are defined as any sudden inheritable change in the DNA or genetic material of an…

Q: Most fungi obtain nutrients from_____ . a. nonliving organic matter c. living animals b. living…

A: Introduction :- Photosynthesis is the process by which plants produce oxygen and energy in the form…

Q: . In an inversion, is a 5′ DNA end ever joined to another 5′end? Explain

A: A chromosome is generally defined in terms of that they are supposed used as a long DNA molecule…

Q: A BIO101 student says, "Dr. Lopes spend all our time talking about DNA, but that's silly because DNA…

A: DNA and RNA are the genetic material. These carry the information from one generation to another.…

Q: Referring to Figure 17-26, draw the product if breaks occurred within genes A and B

A: An inversion is a chromosomal rearrangement where a portion of a chromosome is flipped end-to-end.…

Q: Within an ecosystem, the total amount of energy produced initially by primary producers will be the…

A: Answer :- Option (A) is correct. - More than.

Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…

A: Introduction - Sexual reproduction is a type of reproduction that comprises a complicated life cycle…

Q: Which of the following is the most accurate statement regarding the problem with using life…

A: Option 3 Life expectancy give you average of country but significant differences within groups of…

Q: Defining occupational health and safety and its importance in the work environment.

A: occupational health deals with all aspects of health and safety in the workplace and has a strong…

Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…

Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…

A: The biological information flows through genes. DNA is the main genetic material of most of living…

Q: Use what you know about inflammation to explain how periodontal organisms might be responsible for…

A: Suppose that bacterial plaque builds up in patient's oral cavity (on the teeth). This leads to…

Q: Question 23 Which of the following is an underlying requirement for universal health coverage? High…

A: Which of the following is an underlying requirement for universal health coverage? A. High quality…

Q: Why is Raphanobrassica fertile, whereas its progenitorwasn’t?

A: Raphanobrassica. Any intergeneric hybrid between Brassica (cabbages, etc.) and Raphanus is known as…

Q: What are the species of anaerobic bacteria which can be found in chronic wound?

A: Introduction Anaerobic bacteria are bacteria that do not live or grow when oxygen is present or that…

Q: The critical stages when irrigation is needed are during the flowering or early fruiting stage and…

A: Introduction Irrigation is the process of applying water to the crops artificially through various…

Q: what ate the 3 levels of biological organization of E.coli? Please answer asap and type your answer…

A: First let's discuss what is levels of biological organization, Living things are organized into…

Q: An advantage of gas exchange in water, compared with gas exchange in air is that water usually…

A: Gas change is the process by means of which oxygen and carbon dioxide flow among the bloodstream and…

Q: GROUP 6 Write an essay on the role of magnesium in tolerance of plant species to water and heat…

A: Magnesium is the central core of the chlorophyll molecule in plant tissue. Thus, if Mg is deficient,…

Q: Do phylogenetically proximal species have cells with proximal chromosome counts?

A: Introduction - The idea of phylogenetic species (PSC) The idea of a species as an irreducible group…

Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…

A: Proteoglycans are mucoproteins that are formed of glycosaminoglycans that are covalently attached to…

Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:

A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.

Q: Question 37 During bacterial RNA chain elongation, proceeds ahead of the transcription bubble…

A: The process by which RNA molecules are synthesized on a DNA template is called transcription.…

Q: iscuss the intestinal phase of gastric secretion regulation with examples

A: The digestive system is involved in a variety of processes, including food digestion and nutrient…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: A concussion is a mild traumatic brain injury. How might a concussion acutely affect hearing and…

A: *A concussion is traumatic brain injury which will affects brain function Caused by a blow to the…

Q: Why are older expectant mothers routinely given amniocentesis or CVS?

A: Prenatal diagnostic procedures such as chorionic villus sampling (CVS) and amniocentesis are used to…

Q: vectors. Examine Figure 2 below. Provide three (3) qualitative descriptions of the P. falciparum…

A: Plasmodium falciparum is the causal agent of malaria in humans. It is transmitted to humans by the…

Q: E Which choice best describes the location of the majority of the musculo-skeletal system? A. It is…

A: Introduction Bones, muscles, tendons, ligaments, and soft tissues make up the musculoskeletal…

Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Microorganism A was exposed to different constant temperatures to get the specific D- values.…

A: The z-value is a measure of the change of the D-value with varying temperature, and is a simplified…

Q: Summarize the major scientific findings about human sexual desire, arousal, and response.

A: The human sexual response cycle is a set or sequence of physical and emotional changes that occur…

Q: This conceptual model to the right shows the flow of energy through a spring ecosystem in Silver…

A: Ans 7 a. GPP ( Gross Primary Productivity) - When the producer absorb specific amount of chemical…

Q: The distribution of a herd of deer is shown in Fig. 4.17. Using the values below for the dimensions…

A: Introduction A population is a group of individuals of the same species living in the same region…

Q: Define disinfection. Compare/contrast it with sterilization, antisepsis and bacteriostasis.

A: Sterilization, disinfectant, antisepsis and bacteriostatic all terms are related to halt the growth…

Q: Q.4. Explain why excessive dosage and abusive usage of drugs such as amphetamines, LSD and…

A: Effects of drugs on human :- Seizures, stroke, mental confusion and brain damage. Lung disease.…

Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…

A: Natural selection It is a natural biological process where organisms adapt and change there…

Q: Describe the steps of transcription in eukaryotes

A: Eukaryotic transcription is carried out in the nucleus of the cell by one of three RNA polymerases,…

Q: Species richness quantifies the amount of money each species is valued at on the biodiversity stock…

A: Species richness quantified?

Q: egmentation O Can be fused into specialized functional regions Is seen in insects, worms, and their…

A: The sequence repetition of similar organs, tissues, cell types on different body segments placed on…

Q: Briefly discuss Mendelian Inheritance with that of crossing-over.

A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…

Q: Q.1. What causes adolescents to start using drugs? How can the use of drugs be avoided?

A: A few of the factors that lead to adolescents beginning to use drugs are as follows: Curiosity to…

Q: In a tetraploid B /B /b /b, how many quadrivalent possiblepairings are there? Draw them (see Figure…

A: The number of sets of well define chromosome that is term as homologous chromosomes in a cell's or…

Q: What are the immunological implications of 'bare lymphocyte syndrome' /MHC deficiency?

A: Bare lymphocyte syndrome (BLS) is relatively a rare condition. In patients with this syndrome,…

Q: Compare the prevalence of neglected tropical diseases to the much better known and deadlier…

A: * Non Tropical Diseases can be found in countries like Africa and Asia, and Latin America and…

Q: Q.15. State the principle of vaccination. How can vaccines be used to prevent microbial infections?…

A: Introduction In this question we have to state the principle of vaccination.

Question

Which choice besi describes the location of the majority of the musculo-skeletal
system?
A. It is in the dorsal cavity
B. It is in the ventral cavity
C. It is in the abdomino-pelvic cavity
D. It is not located in a body cavity

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following supports body weight whensitting?a. iliac crestb. ischial tuberosityc. ischiopubic ramusd. pubic body
Overview https://my.pltw X Project Lead T X https://cdr a bethelsd.instructure.com Question 5 Which of the following is NOT a function of skeletal muscles? move fluid substances through hollow organs create movement of the skeleton O generate body heat O determine the range of motion of joints Question 6 Which of the following describes tissues? O A group of cells in the same area of the body. OA group of organs with similar structure and function. Sheets of cells in a box.
Which of these events does not occur with the aging of joints?a. decrease in production of new cartilage matrixb. decline in synovial fluid productionc. stretching of ligaments and tendons and increase in range ofmotiond. weakening of musclese. increase in protein cross-linking in tissues
Which of the following correctly describes the two named body parts? a. The elbow is proximal to the shoulderb. The phalanges are distal to the carpalsc. The ribs are proximal to the sternumd. The elbow is distal to the knee
The skeleton bones such as ribs, sternum and diaphragm protect certain body organs from injuries Select one: O True OFalse Jump to...
Which of the following groupings of the abdominoplevic regions in medial ? a. Hypochondriac, hypogastric, umbilical b. Hypochondriac, lumbar, inguinal c. Hypogastric,umbilical, epigastric d, lumbar, umbilical, iliac e. Iliac, umbilical, hypochondriac
Which of the following statements is true? O The pelvic girdle contains the hips and lower spine. O The pectoral girdle contains the legs and feet. O The pectoral girdle contains the shoulders, arms and hands. O The pelvic girdle contains the shoulders, arms and hands.
How many vertebrae are there in the human spinal column? A. 18 OB. 40 O C. 10 O D. 26
To move bones via contraction Group to Choose a. Circulatory b. Respiratory c. Nervous d. Muscular e. Integumentary f. Urinary
The appendicular skeleton includes O a. Arms, legs, hands, and feet O b. The skull, vertebral column, and rib cage O c. The skull, the scapula, and the vertebral column Od. The skull, vertebral column, and pelvis
What is the major function of the axial skeleton? Question 6Answer a. provide central support for the body and protect internal organs b. give the body resilience c. provide an attachment point for muscles that allow movement d. provide a space for the major digestive organs
The popliteal region is posterior. (anterior or posterior) The acromial region is ________________to the otic region. (medial or lateral) The femoral region is proximalto the tarsal region. (proximal or distal) The bones are ________________to the skin. (superficial or deep)