which amino acid would be carried by a tRNA with the anti-codon 5AAG3?

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

A:

Q: 14. Which mutation would be more harmful to a cell? For each predict the outcome of each mutation…

A: In order to base-pair with the correct codon on the mRNA during protein synthesis, the anticodon is…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…

A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…

Q: Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA…

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: 1a) What amino acid would be coded for by the codon 5'AGG3'?

A: Codons are the trinucleotide sequences of DNA or RNA that specifies amino acids. There are 20 amino…

Q: What two reaction steps are required for the formation of an aminoacyl-tRNA?

A: In molecular biology, translation is the cycle wherein ribosomes in the cytoplasm or endoplasmic…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Draw the chemical structure of the 5' end of nascent RNA transcript in eukaryotes.

A:

Q: Is there a start codon instead of AUG? What is its name and what does it encode?

A: A reading frame includes a start codon and a stop codon.

Q: Are tRNAfmet and tRNAmet made from the same aminoacyl tRNA synthetase?

A: Amino acyl tRNA synthase pairs tRNA with amino acid that their anti codon codes for. Amino acyl tRNA…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: 20 of 22 If a strand of MRNA has the sequence 5'-CUGUCA...ACUC-3' (with [….] representing the…

A: Transcription process takes place in the nucleus. It is responsible for producing mRNA from template…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…

A: tRNA  It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: tRNA possess a set of three nucleotides known as an anticodon. The anticodon of tRNA binds to one or…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: It is important to know how DNA and RNA work together to make proteins. In transcription, DNA helps…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit…

A: The features of RNA that permit self-splicing (that is, in the absence of proteins)is that RNA is…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: What is the DNA sequence that encodes the codon AAG, with 5’ and 3’ ends labeled

A: The DNA sequence that encodes the codon AAG with 5' and 3' ends labelled must be TTC from 3' to 5'…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: Translate the RNA codons using the given genetic code  5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation:  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.