What  type of mutation occurred in the gene sequence that resulted in white-fur bears

Q: Is there a significance in studying the gene structure? Why or why not?

A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…

Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…

A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…

Q: eproduce and spend their lives collecting food, tending the queen, and raising her offspring. ertain…

A: Honey bees are eusocial insects that live in a Colony. The colony consists of two types of females -…

Q: 1) What is the human gene TRNT1?  Explain what the wild type and mutant forms do.

A: TRNT1 is a CCA adding transfer RNA nucleotidyl transferase enzyme. The deficiency of this enzyme…

Q: The first genetic test developed for this disease took advantage of a large family of over 2,000…

A: Huntington’s disease is a neurodegenerative disease. The symptoms of the disease start mildly such…

Q: Contrast the characteristics of prokaryotic and eukaryotic genes. What are the implications for…

A: Prokaryotic creatures are single-celled organisms without a cell nucleus; as a result, their DNA is…

Q: 12 13 14 Which of the following is true of a somatic mutation? A. They are mutations passed on to…

A: a DNA change that takes place after fertilisation. Somatic mutations can occur in every cell of the…

Q: 10. In eukaryotes, the level of chromatin organization (how nucleosomes are packed together) Is…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: historical evidence obtained by Pierre Chambon that led him to conclude that amino acid coding…

A: The coding and non-coding regions of the DNA The coding regions are specifically called exons and…

Q: Explain how genetic rearrangement creates a diverse set ofantibodies in mammals.

A: Japanese scientist Susumu Tonegawa discovered the concept of gene rearrangement. There are number of…

Q: (a) duplicated genes that have lost their function     orthologous genes     paralogous genes…

A: Genes are the basic unit of heredity. They are made up of DNA. The DNA sequence in genes is encoded…

Q: 8. Two independent genes are located near each other on the genome of the mouse. Whiskers is…

A: A gene which dominates the other gene is termed a Dominant gene. And a gene which is dominated by…

Q: 5)Would you expect mutations to always produce recessive traits? Why or why not?

A: Mutations are sudden inheritable variations that occur in an organism's genetic material due to…

Q: Q1: If all genes are composed of just four nucleotides, how can different genes carry different…

A: Biological molecules that are present in living organisms and are involved in various biological…

Q: F in this picture represents female . C = Children. And M = man. The arrow marked at number 1…

A: A laboratory technique called DNA fingerprinting uses a sample of DNA to identify a person by…

Q: Choose a human-related organism to study. As you consider strategies to enhance the social value of…

A: Through genetic engineering one can make use of the advanced CRSIPR and modify organisms, plants,…

Q: 19) Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry oxygen.…

A: Given: Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry…

Q: Explain why a geneticist interested in finding a gene linked to cancer would want to look at the DNA…

A: Cancer is the condition in which control over cell division is lost.

Q: a. What DNA sequences are found at the telomeresof human chromosomes?b. What functions do the two…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: 9. (a) A child has a rare recessive disease due to a mutation in Gene X; both his parents are…

A: Humans have two types of chromosomes, autosomes and allosomes or sex chromosomes. There are 22 pairs…

Q: When comparing evolutionary similarities between different genes within a gene family, it is usually…

A: A gene is a sequence of DNA that codes for a specific protein. Proteins are the building blocks of…

Q: 2. Genetics enables us to understand how proteins interact with one another within the context of a…

A: The study of genes, genetic diversity, and the passing of traits from parents to children are all…

Q: . Neurobiology of speech and language has been studied in a family in which half of the members have…

A: Answer :- option (B) is correct. - Determine the DNA sequence of the FOXP2 gene in several species…

Q: How might transposons be utilized to hereditarily design Drosophila?..

A: In genetics, the set of procedures used to do genetic modification in an organism through the…

Q: What types of behaviours or environmental circumstances can lead to changes in an individual’s…

A: Introduction  Epigenetics is the study of how our behaviour and environment can influence how our…

Q: MCR1 the only gene responsible for the variation in the human skin color?

A: MCR1 (melanocortin 1 receptor)  gene is very well known to be associated with the variations found…

Q: can prevent cancer? 2) Are jumping genes the mechanism by which elephant genes were duplicated?

A: Hyaluronic acid, also called hyaluronan, is an anionic, nonsulfated glycosaminoglycan distributed…

Q: Sequencing of the human genome has revealed much about the organization of genes. Describe the…

A: Tandem repeats are those DNA sequences that make repeated copies of themselves while lying next to…

Q: Contrast the characteristics of prokaryotic and eukaryotic genes. What are the implications for…

A: In eukaryotes the presence of introns and the need for nuclear transport of mRNA for translation…

Q: 1. (a)genes with similar function     orthologous genes     paralogous genes     pseudogenes…

A: INTRODUCTION Answer of question 1 part a and b is given below.

Q: 8. Dioxin (in the human diet!) and ethidium bromide (used in labs to see DNA using UV light) are…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: explain the statement Transposons can move genes to newchromosomal locations.

A: Transposons are referred to as chromosomal segments which can undergo transposition.

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: Gene expression is... How genes are replicated into two new strands identical to each other How…

A: Gene expression is the process in which DNA is transformed into a functional product such as…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.