Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A rec...
A: Given information Antigen A and antigen B in red blood cells need H antigen for expression. A reces...
Q: describe how stress is a process. Include stimulus, response and process
A: There are few points : Stress can be defined as it is impossible to avoid . It is an external event...
Q: A homozygnous Dominant brown mouse is crossed with a heterozynous Brown mouse(tan is ressesive color...
A: A gene is a piece of DNA that contains the instructions for a specific feature or attribute. Heteroz...
Q: A phlebotomist, named Toru, is sent to the Emergency Room to collect an EDTA specimen for a stat typ...
A: Introduction: Phlebotomy is the process of inserting a cannula into a vein to extract blood. Venipun...
Q: 0.001234286 0.001801429 0.002045714 -4.14286E-05
A: An enzyme is a biological catalyst which increases the rate of reaction by reducing the activation e...
Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...
A: The allele for Black XB Allele for Yellow XY So the possible genotype of calico female= XBXY (black ...
Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive flies are crossed...
A: Given: In flies, long wings(W) are dominant to short wings(w). Dominant traits are always expressed ...
Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCT...
A: Transcription: The process of formation of RNA from the DNA by action of DNA dependant RNA polymera...
Q: A.) DNA encodes for the cell genome and is therefore a permanent copy to have a functioning cell. B...
A: The two statements given in the question are : A.) DNA encodes for the cell genome and is therefore...
Q: Check All That Apply As exposure to X-rays increased, the ratio of type 1 to type 2 outcomes increas...
A: 1. What results did muller obtained? ANSWER: The explanation for the aforesaid experiment is given b...
Q: Help explain this LAPTM5 and LAPTM5 restrict HIV-1 infectivity
A: Answer
Q: Which of the following is not one of the resources that Watson and Crick used to solve the structure...
A: ANSWER;- d) Labeling of DNA with radioactive phosphorus(32p). Explain;-Covalent adducts framed by th...
Q: What is a redox reaction?
A:
Q: Differentiating Monocots and Dicots
A: Angiosperm - the term is derived from the greek work angeion and sperma . this plant are having seed...
Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...
A: dominant stands for a characteristic that is more likely to be expressed in the offspring than the r...
Q: 3. Explain the term Refractive Index (n) of liquids, and describe how the values may be measured exp...
A: Refractive index It determines how much light is bent, or refracted when entering a material. When l...
Q: 4. How can the different gene interactions be differentiated from each other and from the Mendelian ...
A: Answer:- Mendelian inheritance refers to the expression of monogenic traits, i.e. gene expression is...
Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? 7. 8. Sulfhydry...
A: Introduction:- Alcohol is dispersed throughout the body's fluids, exposing most tissues, including t...
Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...
A: Endocrine and exocrine systems are both present in the human body. Endocrine and exocrine systems ar...
Q: Explain Affinities of Gnetales.
A:
Q: Biomolecules such as Such as utsimCarbohydrates amino acids DNA Oil for example monomer such as mono...
A: Biomolecules are the most important organic compounds in living creatures since they are involved in...
Q: 94. Which of the following is TRUE of DNA polymerases of eukaryotic cells? a. The same DNA polymeras...
A: DNA polymerase is typically used in the DNA replication process. Beta DNA polymerase is a subtype t...
Q: What are three actions you would take to reduce theglobal threats to human health and life from each...
A: Pathogenicity represents a specialization in a certain microorganism to replicate and damage host ce...
Q: In the figure above, structure A is and structure B is
A: The corti is a complex epithelial structure in the cochlea that contains hundreds of hair cells and ...
Q: Describe the interactions of adrenal medullary and cortical hormones in response to stress (Cannon's...
A: Hormones of adrenal cortex especially cortisol responsible for long term stress however hormones of ...
Q: Basic Alternation of Generations. What are the structures in plant life cycle that are haploid?
A: Alternation of generations means that the plant's life cycles alternate between diploid (sporophyte)...
Q: Living Things Mammals Fish aroups? Give birth Lay eggs Can fly Cannot fly Give birth Lay eggs panda ...
A: INTRODUCTION Living things are organisms to constitute there life. Living things are mainly s...
Q: What are the three big ideas of this chapter? Explainhow making the transition to more sustainable f...
A: "ANSWER An estimated 1 billion people suffer from malnutrition. Modern industrial agriculture harm...
Q: 1. Why do we pass the smear in the open flame of the bunsen burner 3 times? What do we want to achie...
A: 1.sampling usually have the following stages to identify the bacteria. Staining smear preparation H...
Q: Classify and diagram embryos on the basis of their: (a) yolk content, (b) cleavage types, (3) cleava...
A: Cleavage in animals is depends upon amount of yolk. Yolk distribution can be complete ( holoblastic ...
Q: Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a. Fix...
A: Coding sequence codes for functional protein products. Coding sequence codes for the functional prot...
Q: Identify the major physiological and pharmacological actions of glucocorticoids on energy metabolism...
A: Introduction:- Cortisol is a steroid hormone that is produced in the cortex of the adrenal glands an...
Q: Describe active transport, including cotransport.
A: Introduction :- The movement of molecules across a cell membrane from a lower concentration region t...
Q: which objective lens is in place if the object you are viewing is magnified 1000x? (assume ocular le...
A: As if we known that microscope amplifies the image of an object, a microscope is widely used to vie...
Q: 7. In simple terms, describe how crossing over is carried out. How does it generate variability?
A: The interchange of genetic material in the germ line is referred to as crossing over.During meiosi...
Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...
A: The study of what makes a certain action in a specific scenario the proper thing to do is known as e...
Q: Which vertebrates have a lateral line system and which do not?
A: Answer
Q: WHAT ARE THE CONCEPT AND IMPORTANCE OF THE FOLLOWING? I. Translocation through an artificial membran...
A: Osmosis is the spontaneous net movement or diffusion of solvent molecules through a selectively perm...
Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...
A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...
Q: Why is it surprising that humans consumed milk products long before the existence of the gene mutati...
A: * milk products mainly consists of sugar Lactose which will be digested by the enzyme Lactase * Lon...
Q: Q. The number of ways to give 13 different things to three persons A, B, C so that B gets 1 more tha...
A: Let the things given to A be x B = x+1 C = x+1+2 C = x+3 A+B+C = 13 3x +4 = 13 3x =13-4 3x = 9 x=9/...
Q: onic bonds and covalent bonds.
A: The main difference between the ionic bonds and covalent bonds is sharing of electrons between the a...
Q: that discusses the Polarized state (mV inside the neuron, ions present/abundant inside and outside, ...
A: A plasma membrane surrounds a neuron, much like any other cell, and it is semi-permeable, allowing o...
Q: 1. To create a fully functional protein, how do their structure help in determining its function? 2...
A: 1. A fully functional protein is generally found in tertiary or quaternary structure. The tertiary p...
Q: Give an example of an animal in this food web at each of these trophic levels
A: In a food web, the primary producers are always the green plants and algae. Other animals cannot syn...
Q: 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with ...
A: The given circular DNA data indicates that amoeba is closely related to ancestral cell however lizar...
Q: Explain why we say that photosynthesis feeds most life on Earth.
A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...
Q: Which parameter from the software must you adjust in order to permit gene flow? Select One. Startin...
A: Population genetics is study of genetic compositions of populations, with changes in frequencies of ...
Q: Viruses are capable of infecting bacteria by injecting their DNA into the bacterial cells. This was ...
A: Viruses are capable of infecting bacteria by inserting their DNA into the bacterial cell. This w...
Q: TERM MAIN ENTRY (Pronunciation) MEANING (Definition)
A: Term Main Entry Meaning Aphasia uh-fay-zee-uh Inability to understand or produce speech, as a resu...
Step by step
Solved in 2 steps
- Considerthefollowingscenarioandanswerthequestionsthatfollow: Scenario:anaquaticsnailisplacedinatesttubefilledwithwaterand placedinasunnyenvironment. 1.Doesphotosynthesisoccur? 2.Doescellularrespirationoccur? 3.Willtheorganismliveordieifit remainsinthisenvironment? 4. Justify your answer to #3.ScX O 2020/ X Chapt O Pla + x ti Grades x - Micros x Attach x 2 Edpuz x (1) Dia x A quizizz.com/join/game/U2FsdGVkX19u5PV2q0828jgMm6BEgGF6fEPUbfvRFnusX%252BvbgoJX50wVADbL6X.. Johnson - Bo.. A Classes Course stream ti Planner - ProgressB. Holt McDougal Onli. G snake - Google Sear. O YouTube C 2KMTCentral | NBA A Actively Learn 1/7 Streak Whose research suggested that DNA was helical? Chargaff Watson Crick FranklinMarit X K Marit x K Marit x K Marit x K Marit X K Marit x K Marit x K mea X amihq.com/web/viewer.html?state=%7B"ids"%3A%5B"1Pnete_jWal4wBT4oiRDhFTYO4KGTeuMI"%5D%2C"action"%3A"op P A Kami Schoolo. X-linked Traits Assignment.pdf 100% Times New Roman 14px 1.5pt : BIUS A A X2 x2 E E Gemeuux. A LIIKCU Genes In fruit flies, eye color is a sex linked trait. Red is dominant to white. 1. What are the sexes and eye colors of flies with the following genotypes: XRX' XRXR XRY XY L 2. What are the genotypes of these flies: white eyed, male white eyed, female red eyed female (heterozygous) red eyed, male 3. Show the cross of a white eyed female X 'X'with a red-eyed male X Y 4. Show a cross between a pure red eyed female and a white eyed male. What are the genotypes of the parents: & How many are: white eyed, male white eyed, female red eyed, male red eyed, female
- Why not vit D?Downloads G https://quizizz.com/joln?gc 組■回 O O 4x * -> A quizizz.com/join/game/U2FsdGVkX19TkkG3kLlisiMvowuyNnqAj4DOrKAİ%252BrxJxaTyev6Woj05VE1vYBQ81Qrk%252.. DeltaMath G Sign in - Google Ac. C Campus Portal Desmos | Graphing.. O Copy of Cherish sto. G Continue the Conve. 国 Readil HCS Bookmarks Y 10th 27500 +200pts What is the art of persuasion? rhetoric pathos ethos logos Music off O v1 3:17 CopCan u help me to explain to me part a, part b, part c, please? I stuggled.
- Part I – SymptomsCallie was 26 years old when she opened a bakery called “Callie’s Cupcakes” in downtown San Francisco with herf ancé, Jeremy. Despite the competitive market, her business was booming; everyone loved the clever recipes and thetrendy atmosphere. Between running their fast-growing business and planning for their wedding, Callie hadn’t beenable to keep to her usual eight hours of sleep a night. Although she had always lived a very healthy lifestyle, exercisingdaily and eating healthy, she just hadn’t been feeling herself lately. She was tired all the time, had dif culty breathing,felt stressed, coughed up sputum, consistently ran a low-grade fever, and had lost weight as her appetite decreased.None of these symptoms alone had been particularly alarming so she had put of seeing her physician for a few weeks.Questions1. What are Callie’s symptoms? List all that were mentioned.2. Based on the symptoms presented, what are three possible respiratory infectious diseases Callie…choose correct option nd do explain shortly plz.Of Central Flori X Home Page | My CF cf.instructure.com/courses/1752582/quizzes/3318241/take/questions/68618671 22FA ome nouncements ades odules ages ssignments iscussions yllabus uizzes Collaborations 16 College Policies, mportant Dates, and Resources Google Drive Badges Labster here to search W S X that the 15 TONWie de contar com BUY ordine a argitar textbook on the same computer being used for the exam as "leaving". If you are using textbook notes/materials during a exam, they must be on non-electronic or on a separate device. You will only have 1 attempt at this exam. Question 6 E $ 1 ܓܕܝܐ O morbid. Human papillomavirus (HPV) infections often go undiagnosed because the host does not notice any signs or symptoms. In these cases, HPV is cytotoxic. O hemorrhagic. O oncogenic. O inflammatory. O asymptomatic. C O R % F UL Quiz: Exam 5 (Chapters 15-18) S T G < Previous L Y B hp + 7 H D 3.5 pts N Next ▸ त्र Rain... S ✰ TANNACTION X Time Running: Hide T Attempt due: Dec 3 at 11:5 1 Hour,…
- K Miloura Paul - Biology_Unit 4 Pc X Seplquatic volve Sel Ciline fcal th CareX : m cceaianment A web.kamihq.com/web/viewer.html?state=%7B"kds%3A%5B 1 jGujPYSxQlex4AFCn8zftVSgM5PIG%5D%2C*action"%3A'open%2C'userld %3A"1129860039 E Miloura Paul - Darw. 100% A Kami Uploads Miloura Paul - Biology_Unit_4_Post_QuizEnzym Student Version pdf Cells in the stomach produce pepsin, an enzyme, to help digest food. Pepsin works best at a pH of 2. Which of these graphs most likely shows what will happen to the activity of pepsin as the pH of the stomach is increased? 2. EFFECT OF pH ON PEPSIN ACTIVITY A. EFFECT OF pH B. ON PEPSIN ACTIVITY pH pH EFFECT OF pH EFFECT OF pH ON PEPSIN ACTIVITY C. ON PEPSIN ACTIVITY pH pH DELL 23 2$ & 4 7 Pepsin Activity Pepsin Activity 5 Pepsin Activity Pepsin Activity COParasitism Mutualism O Commensalism Clear selection In Africa there exists an unusual relationship between ants and the Acacia tree. The tree sap provides food for the ants, and the ants protect the tree from predators. O Parasitism O Mutualism O Commensalism Athlete's foot is caused by a fungus that grows on the warm moist skin of the people, often around the toes of the feet. It may cause severe itching andCATGATACAAGGCCCTTCCGGTACAACCACTTCGGTAGAAAGCCTTTCGGAGACCGTCCCTTOGGCAGACGCAACmI cear CA PESCA CROOngm O uaNOCIGa P L CEIC00PORMORlg mcaGccCTTCCGGT 916 10 5'UTR 20|JATG 3b 50 Leader 60 80 100 1 110 130 160 2 40 70 90 120 140 150 170 180 190 ....I....I....I....I.. ..r....I........I....I....I....I....I....I........I....I....I....I....I....I....l....I....I........I....I....I.......I....I....I....I....I....I....I.........I .1....I.... DQ183132 DQ183133 DQ183134 ...2 -TCGGAGAGACTATTACTAACATG TCGGAGAGACСТАТТАСТААФАТО TCGGAGAGACCTATTACTAACATG 3 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCCCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCGCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185…