What purpose was served by filtering the milk sample after the addition of acid?

Q: Explain the process of Drug Elimination

A: Drug elimination is the removal of drug from the body.

Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…

A: Given  P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…

Q: (8) B-ketothiolase is a multifunctional enzyme in lipid catabolism. Which of the following is NOT…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…

A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…

Q: Explain the mechanism of Warburg effect and how it benefits cancer cells

A: Cancer means uncontrolled cell growth. This uncontrolled cell growth may cause a lump of cell or…

Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…

A: Vitamins are essential nutrients that are important for the protection of body from diseases.…

Q: Explain what Hepatocyte hopping is

A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…

Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…

A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…

Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…

A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…

Q: Does the change Glu®Val (Eb6V) explain the unequal migration of HbA and HbS in your gel?

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. O True…

A: Leydig cells secrets testosterone in male body. In female body ,granulose cells of the ovaries…

Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…

A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…

Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…

A: A metabolic pathway is a chain of biochemical reactions linked together by their intermediates.…

Q: of Mg2+.Classify each analyte based on its level in the soil sample

A: Amount of soil sample = 2.65g                          In mg      = 2.65 × 1000             = 2650…

Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…

A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…

Q: Time left 1:48 37 Please describe the digestion process of proteins in the whole digestive system.…

A: In process of digestion, complex molecules are converted to simple molecules with the…

Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…

A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…

Q: Insulin is a hormone that regulates the glucose level in the blood. Today, human insulin with this…

A: Insulin is a pancreatic hormone that stimulates the transport of glucose from blood to muscles and…

Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…

A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…

Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…

A: The human body is a complex system that requires energy to operate effectively. At the cellular…

Q: 1. What are the major functions of lipids?

A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…

Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…

A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…

Q: 10. Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…

A: Parkinson's disease is commonly seen in adults after the age of 50. Parkinson's disease is known to…

Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…

Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…

A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…

Q: Arginine is considered a basic amino acid because its side chain ________ at physiological…

A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…

Q: Significance of proteins in CSF and how to determine the cerebrospinal fluid analysis protein.

A: Protein, like the enzymes, blood, and cerebrospinal fluid, may be found in practically all human…

Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…

A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…

Q: Illustrate and summarize ketogenesis.

A: Ketogenesis is one of the biochemical pathways. The process of ketogenesis occurs in the liver. The…

Q: 12. You can distinguish epinephrine hydrotartrate from norepinephrine hydrotartrate by: A. Water…

A: Hi, thanks a lot for submitting the multiple questions. As we are allowed to answer one question at…

Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…

A: Morphine is pain medication which is used in Treatment of pain.this is belongs to opiate family.…

Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…

A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…

Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…

A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…

Q: When phospholipids are dispersed in an aqueous solution, they will often form more ordered…

A: The phospholipids are the principle constituents of the cell membrane.

Q: Why egg whites and milks are used as antidotes for heavy metal poisoning?

A: Heavy metal poisoning is a process in which an organism is exposed to excessive amount of heavy…

Q: Why are they so designated?   Ketone bodies are so named because they contain the ketone functional…

A: Ketone bodies are produced by the liver during caloric restriction.

Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\

A: Retention factor The amount which each component of a mixture travels can be easily quantified using…

Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA

Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…

A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…

Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…

A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…

Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: What types of monomers make up a carbohydrate? What are carbohydrate polymers called?

A: Carbohydrates are biomolecules made up of carbon, hydrogen, and oxygen. The ratio of H and O is the…

Q: n the discovery of new drugs, the chemical and physical properties of a molecule are very important…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: True or False? It takes Carbon dioxide and water in the presence of sunlight to produce…

A: Carbohydrates are formed in green plants by the process of photosynthesis.

Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…

A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…

Q: Fill out the table below. Determine whether the rate of the metabolic pathways will increase or…

A: Regulation of blood glucose is largely done by endocrine hormones , through a negetive feedback…

Q: How to calculate the amount of myoglobin in grams from a 2.0 ml sample of protein extract???

A: Beer Lamberts law states that  value of Absorption at a particular wavelength of light by an analyte…

Q: POST-LAB QUESTIONS 1. When a reducing sugar reacts with Benedict reagent, what organic product is…

A: 1. The Benedicts reaction with reducing sugar is given below. Reducing sugars can be either in…