What is the net charge on this peptide from the given DNA sequence? What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence?5' GTTCTCACТАСAGC 3'

As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Answered: What is the net charge of the peptide…

Science

Biochemistry

What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5' GTTCTCACTACAGC 3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 15QP

See similar textbooks

Related questions

Q: DIR TION: Express the following DNA nucleotide bases into amino acids A. 1. 3' ATA TTT CCG TAC CGC…

A: Gene expression is the process by which information from a gene is used in the synthesis of a…

Q: 1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Using the nucleotide sequence of an accession number (NM_019121) what is the translated amino acid…

A: Proteins are made up of amino acids. DNA is the genetic material that codes for the amino acids that…

Q: Snake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…

Q: What group is added to modify methionine on the initiator tRNA in bacteria O phenyl O formyl O…

A: Initiator tRNAs (tRNAi) transport methionine (or its product, formyl-methionine) to ribosomes, where…

Q: Isoleucine is encoded by three codons (5')AUU, (5')AUC, and (5')AUA. These three codons are…

A: Wobble hypothesis: This hypothesis was given by Francis Crick. According to this hypothesis the…

Q: Pyridoxal phosphate (PLP) has the main function of converting one type of amino acid to another…

A: Cofactors are molecules which are needed by enzymes to complete thier activities . Without them…

Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…

A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…

Q: A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary…

A: Ribonucleic acid (RNA) is a single-stranded polymer of ribonucleotides. Each ribonucleotide unit is…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . .…

A: The mutation occurs when there is an error in the sequence of the DNA. It could be because of the…

Q: An enzyme isolated from rat liver has 193 amino acids and is encoded by a 1440 base pair long gene.…

A: Question - An enzyme isolated from rat liver has 193 amino acids and is encoded by a 1440 base pair…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Which amino acid repeat pattern would most likely form a stable a-helix with one hydrophobic side?…

A: Amino Acids are biochemical molecules that combine to make proteins; as a result, they are referred…

Q: A mutation called base substitution mutation had been altered the sequence in a. eliminated the…

A: Base substitution is a type of mutation in which one nucleotide base is substituted by the other and…

Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: Consider this nucleotide sequence of DNA strand. 3' A GATTA C C C G C TATA TATTGTA 5' 10 11 12 13 14…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…

A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…

Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?

A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…

Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…

A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3' From above sequence…

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: In the sequence 5'-TCCGGA-3, an available phosphate group would be found at the 5' end of the…

A: Introduction: A nucleotide is an organic molecule that consists of a nitrogenous base, pentose…

Q: Why is it important that the correct reading frame is used?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: Is N-formyl-methionine used to start translation in eukaryotes? Yes No

A: Translation is the process in which ribosomes synthesize proteins after the process of transcription…

Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…

A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’…

A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…

Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: Mutations can be defined as the sudden changes which occur in DNA. These changes can be a result of…

Q: From this overall anticodon sequence in tRNA,…

A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…

Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…

A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…

Q: Hhal is a 4-cutter restriction enzyme that creates 2-base, 3' overhangs ("sticky ends") and…

A: Restriction enzymes can cleave the DNA sequences at the recognition sites, also known as restriction…

Q: 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this…

A: Introduction DNA is a self replicating molecule. DNA synthesis occurs during the S phase of the cell…

Q: hy do we keep tissue samples for RNA work in liquid nitrogen (-196°C)? Why do we want to…

A: DNA and RNA can be extracted from the cells for several analytical and other processes by…

Q: Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran…

A: A protein can arrange itself according to requirements. It can be primary, secondary, tertiary and…

Q: For the case n = 5, the equilibrium constant for this reaction, Keg, is 5-10³ and for n= 6 Keg =…

A: Thermodynamics in biochemistry is the quantitative study of the change in energy which occurs in or…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…

A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…

A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…

Q: The Hemagglutinin protein in Influenza virus contains a remarkably long a- helix (7.95 nm) with 53…

A: Option H, 14.7

Q: What's the minimum number of tRNAs needed to translate Phenylalanine (Phe) based on the genetic code…

A: tRNA is transfer RNA that acts as a nucleic acid decoder. This plays an important role in the…

Q: E. coli oriC is rich in A · T base pairs. Why is this advantageous?

A: E.coli is a gram-negative bacteria that is found in the lower part of the intestine if warm blood…

Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Concept explainers

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.

Question

What is the net charge on this peptide from the given DNA sequence?

What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence?
5' GTTCTCACТАСAGC 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

you have the following peptide Arg-Ile-Pro-Leu-Asp-Lys-Glu The net charge on this peptide at pH 7.0 is ?. The net charge on this peptide at 1M HCl is ?.
Given the peptide Val-Ser-Gln-Lys The lateral chain of one of these amino acids can be modified by N-acetylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7 The lateral chain of one of these amino acids can be modified by phosphorylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7.
The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()
5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
draw the structure of the peptide Asp - Asn-Ser-Lys-Pro at PH 8
what would the net charge on the tetra peptide of sequence ala-lys-glu-ser at ph 7.2 what would it be if the amino group of the Lys residue has been acetylated?
A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
The bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the free diff usion of Na+ and K+ ions, thereby killing the cell. This peptide consists of a sequence of Dand L-amino acids. The sequence of a segment of fi ve amino acids in gramicidin A is R-Gly-L-Ala-D-Leu-L-Ala-D-Val-R′. Complete the Fischer projection below by adding the correct group to each vertical bond.
Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide Thr-Asp-Arg. N-terminal amino group = 9.10 Side chain of aa #1 = Side chain of aa # 2 = 3.86 Side chain of aa # 3 = 12.48 C-terminal carboxyl group = 2.01 PI =
A peptide with the primary structure Lys-Arg-Pro-Leu-Ile-Asp-Gly-Ala must be synthesized by the methods developed by Merrifield. Calculate the percentage of the peptides synthesized that will be full length and have the correct sequence if the addition of each amino acid residue is 96% efficient. Do the calculation a second time but assume a 99% efficiency for each cycle. full-length peptides with the correct sequence if 96% efficient: full-length peptides with the correct sequence if 99% efficient: % %
A At pH 5, what is the net charge of the peptide Val-His-Gln-Cys-Ser-Lys? 0 -1 0 0+1 Ⓒ +2 Q Search "de 96 5 ******* ******* 131183 J- C 8 a hp
Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 15 Residue Number ILYYAGSREDHSGYLIL EQSDTERNQHGALIYLI LIFLAIFPAGSTSEDRR RAFLILFMTYFLILFLI LHGDQNRERDGHSQERD 2 Hydropathy value 0 -4 -2