Q: Lassa virus is endemic in which of the following countries? a. Nigeria b. Nicaragua c. India d.…
A: Lassa virus causes the fatal haemorrhagic fever also called as Lassa fever. The reservoire of this…
Q: Table 14.1 Events of Mitosis and Interphase Interphase Although interphase is not part of nuclear…
A: Mitosis is a type of cell division in which one cell (the mother) divides to produce genetically…
Q: Enzyme immunoassay tests are used to screen blood specimens for the presence of antibodies to HIV,…
A: An enzyme-linked immunosorbent assay, also called ELISA or EIA, is a test that detects and measures…
Q: You collected 1000 mL of river water from the stream running through campus. You prepared dilutions…
A: Serial dilution is a common laboratory technique for lowering the concentration of a substance in a…
Q: You just made a 1.5M permanganate solution. What concentration is your potassium permanganate…
A: Concentration of a solution is the amount of solute dissolved in the given amount of solvent for a…
Q: 2) Which of the following statements best describes the results shown in the following graph? Plant…
A: Mycorrhizal fungi form mutualistic associations with the roots of most plant species in natural…
Q: 6 year old child comes in with crusted pustules localized around her mouth. When the doctor finds…
A: Staphylococcus aureus is a Gram-positive spherical bacterium. It is the leading cause of skin and…
Q: What effect does stretching the muscle have on contractile strength? Is this effect linear? What…
A: Stretching a muscle before contraction can have different effects depending on the type and duration…
Q: Patient Barry King is a 27-year-old, asthma patient with COVID-19, who now needs Mechanical…
A: Based on the patient's clinical presentation and ABG results, the following ventilator orders are…
Q: Question: Further Research A smooth (gracile) skull of a female appears quite different from the…
A: Male skulls are heavier and thicker than females. And the bones are thicker. Muscle attachment…
Q: which handwashing treatment produced the highest number of colonies on the after side compared to…
A: ANSWER) Handwashing is necessary technique used for the prevention of entry of microbes into the…
Q: Abundance (percentage of 20 plant cover) 15 Species 15 Plots without Rudbeckia laciniata 10 10 10 5…
A: Diversity indices are used to measure the diversity of a species in the community that is being…
Q: Describe ATP, its role in cellular energy, and its production by phosphorylation.
A: ATP : A nucleotide with three phosphates is called adenosine triphosphate (ATP). Phosphorus is…
Q: How much daily pasture dry matter (kg DM per day) does a 60kg female sheep (at maintenance) would…
A: Maintenance in female sheep (ewe) is the period after lactation during which ewe only need to…
Q: Explain the physiological mechanisms that drive the changes in heart rate between conditions. 1)…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Discuss the significance of the chondrogenic layer of the perichondrium
A: Introduction The connective tissue layer called the perichondrium lines the body's cartilage. It has…
Q: State and explain Mendel’s three Laws of Heredity. b. Mendel’s studied the inheritance of seven…
A: Mendel's work laid the groundwork for modern genetics and provided a fundamental understanding of…
Q: Which of the following statements is true about macrolide antibiotics? Multiple Choice 1-They are…
A: Antibiotics are the group of medications produced by certain microorganisms to inhibit the activity…
Q: 2. Using Chapter 40 (especially Fig 40.4) of our textbook, compare the circulatory systems of the…
A: Frogs are amphibians, which means they can live on land as well as in water, whereas perch are fish…
Q: Discuss briefly the principle behind the staining method used to visualize the reticular fibers
A: Introduction Extracellular matrix (ECM) fibres of the reticular variety can be detected in…
Q: the exposures and outcomes from the following statements and match as appropriate. (There are more…
A: The exposure variable have a certain effect which is produced as a outcome variable. Thus there is a…
Q: 12. Salps are a type of gelatinous zooplankton that look similar to jellyfishes. How is their…
A: Salps and jellyfish are both gelatinous zooplankton that float and drift in the open ocean, but…
Q: Relate histopath criteria of cancer to H nana cell cycle & chromosomal instability.
A: Histopathological criteria of cancer refer to the microscopic features of cancer cells and tissues…
Q: Photoreceptor cells form glutamatergic synapses onto bipolar cells and when photoreceptor cells are…
A: When photoreceptor cells are illuminated, they hyperpolarize due to the closure of cation channels.…
Q: Galen performed vivisection, or live experimentation, on animals to learn about the nervous system.…
A: Galen was a noticeable Greek doctor and anatomist who made important contributions to the field of…
Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…
A: Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations can be fixed using the…
Q: 5. If you could only save five marine arthropods from a sudden extinction event, choose five…
A: Marine arthropods are a diverse group of invertebrates that live in saltwater environments such as…
Q: The mean egg size is 120 grams, with a variance of 480 grams2. You plot out the results with the…
A: Heritability is defined as the physical variation in traits that arise due to genetic factors. It…
Q: Can you help with d? D. Actual configuration of the parental chromosomes in the trihybrid plant is…
A:
Q: The spreadsheets you used to report your results should have automatically charted Angela's data…
A: We are given data about two doses of vitamin C given to a subject. The concentration of vitamin C…
Q: Explain the structure, mechanisms, and the role of the skin in maintaining a normal body temperature
A: Introduction Skin is the covering of internal Organs and tissues . It is the largest organ in the…
Q: Do you think that your hand were "sterile" after any of the four treatments? (only water, Ivory soap…
A: The effectiveness of different hand cleanliness strategies in setting up hand sterility is the…
Q: What types of granules are present within granulocytes? Give the functional importance of these…
A: White blood cells, also known as leukocytes, are a type of blood cell that are an essential part of…
Q: Review Figure 1-8, "Antibody Panel, Case 1-6." In this case study, antibodies are excluded only if…
A: Antibodies are proteins produced by the immune system in response to the presence of foreign…
Q: Question 70 Two students developed models to show how information in genes is expressed as proteins…
A: DNA (Deoxyribonucleic acid) is two stranded helical ladder like structure that functions as genetic…
Q: Choose the phrase that best describes the role of a cloning vector. A) Separates fragments of DNA…
A: Introduction Cloning is the process of creating genetically identical copy of an organism or a…
Q: Question 13 Which of the tissue components gives the most when stretched? O Elastin Osteoblasts O…
A: The musculoskeletal system is the system of the body that is responsible for providing support,…
Q: The main component of an optical microscope that is used to focus an image at a high power of…
A: Optical microscopy is a method used to closely examine a sample using a lens's magnification and…
Q: Irreversible organ failure remains a worldwide concern as demand for transplantable organs far…
A: Neomycin: Neomycin is an antibiotic medication used to treat or prevent bacterial infections. It…
Q: 1. What is/are the wavelength(s) of maximum absorbance for each of the four photosynthetic pigments?…
A: Plants produce pigments, which are collections of various natural chemicals that give the world…
Q: knowing that the Control is 6.22 x 10-20 moles.channel-2sec-1 and CFTR-CRISPR: 3.84x 10-20…
A: Immunostaining using Quantum Dot fluorescence is a technique that combines the specificity of…
Q: 1. Which of the following is not a difficulty that medicine has encountered in its attempts to cure…
A: Gene therapy is a medical approach that aims to treat or cure diseases by replacing, repairing, or…
Q: Rate the structures below based on their sizes with 1 being the biggest and 4 being the smallest.…
A: Gymnosperms are a group of seed-producing plants that include conifers, cycads, ginkgos, and…
Q: I would like to know where is this information from, that way I can make citations id it is…
A: A simple , safe and effective way to protect ourselves against harmful disease before come into…
Q: Why is spectrophotometric analysis light longer than fluorescent molecule activation light?
A: Spectrophotometric analysis is a technique used to measure the amount of light absorbed or…
Q: Types of immunological tolerance
A: Immunological tolerance is a state in which the immune system does not mount an immune response…
Q: Basic and functional parts of the lymph node
A: The lymphatic system is a network of vessels, organs, and tissues that collaborate to keep fluid…
Q: Which of the following statements is true? Multiple Choice Malaria produces minimal changes in…
A: Protozoa is a diverse group of unicellular eukaryotic organisms that can cause a variety of diseases…
Q: Which of the following is NOT part of mitochondrial structure? Outer Membrane O Thylakoid membrane O…
A: Mitochondria are organelles found in most eukaryotic cells that are responsible for generating…
Q: If two glomeruli were fused and functionally connected together in the olfactory bull, what type of…
A: Glomeruli are clusters of neurons in the olfactory bulb that are responsible for detecting specific…
What is the diffrence simular from BA in Biology and BS Biology. What jobs can I get with both? Can I be a Microbiologist with both?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Help me, please! I wish I have a lot of time to do it by myself ... This is the article link and a microbiology open Stax book link for chapter 16 terms. Please help me to find answers. https://piercemil.instructure.com/courses/2180982/assignments/24927088 https://openstax.org/books/microbiology/pages/15-2-how-pathogens-cause-disease#OSC_Microbio_15_02_Invasion Questions: If possible please write the pg of an article with related Answers; it will be easier for me to describe in detail. Thank You for Helping me. Using the terms found in the “Patterns of Incidence” subsection in Chapter 16, what pattern of incidence best matches the outbreak described in the article? Using the terms found in the “Pioneers of Epidemiology” subsection in Chapter 16, which discusses “spread”, what type of spread of the pathogen best matches the outbreak described in the article? Be specific. What type of epidemiological study was used to identify the source of the pathogen in the article? Be specific.…Answer the following questions: 1. What was the first antibiotic and what was its importance? 2. What does resistance mean? 3. Who is affected by resistance? 4. What if the resistance problem is not solved? 5. Describe the structure of the bacterium (its parts) 6. Can bacteria change? explain 7. Why do Bacteria communicate, what is the purpose? 8. Explain how a bacterium achieves its resistance. 9. What is the use given to antibiotics in production animals? 10. Is this use in animals good practice? 11. Once resistance occurs, what has the scientific community had to do? 12. Do antibiotics only affect negative bacteria? explain. 13. What are the most feared diseases due to antibiotic resistance? 14. Should antibiotics be used against viruses? explain. 15. How can we avoid antibiotic resistance?My professor instructed me to make presentation on this topic "Periodontal microbes interaction with FISH". I have to make 4 power point slides regarding this topic. Can you give some information about the topic which i can use in the slides? Also provide some necessary relevant diagram or image regarding the topic. Please answer at your own easy words. If you do so i will rate you positive, Thank you.
- How do I start a term paper about infectious diseases? What should I include?I need help with microbiology/2010 Define the following terms: culture: synthetic media: complex media: agar: colony: normal flora/normal microbiotaMost hospitals use hand sanitizers that claim to “kill 99.99% of illness causing germs”. What are some possible reasons that 0.01% of germs (germs = microorganisms and viruses) not affected by hand sanitizer? (In your answer, you should state what hand sanitizer is made of, and the mechanism by which it kills “germs”.
- om/webapps/assessment/take/launch.jsp?course_assessment_id%= 498749_1&course_id%3= 111786 1&content id3= Ac... Customize Links Free Hotmail Windows Windows Media Imported From IE Importe Differential . QUESTION 4 What do you do in between each streak on a streak plate? Dip the loop into the cultureThis article highlights a young doctor at Elmhurst Hospital during the beginning of Covid-19 pandemic. Dr. Zikry is quoted as saying: “It’s become very clear to me what a socioeconomic disease this is...”. In addition, the textbook discusses the personal variables and socioeconomic status (SES) that are used to find patterns in disease (pp.112-118). What do you think Dr. Zikry meant by referring to the SES of his patients? Why was it important to find a pattern of personal variables and SES among the of victims of Covid-19 at the beginning of the pandemic?I need help answering this question to my professor: The topic for the discussion was this one: Some potentially pathogenic bacteria and fungi, including strains of Enterococcus, Staphylococcus, Candida, and Aspergillus, can survive for one to three months on a variety of materials found in hospitals, including scrub suits, lab coats, plastic aprons, and computer keyboards. What can hospital personnel do to reduce the spread of these pathogens? My answer was this one: To reduce the spread of these pathogens an infection control protocol should be followed. Some ways in which this could be reduced is by using desinfectants, sterilization, hand washing, and disposing techniques. In addition, I currently work as a dental assistant at Jackson Main and the protocol we use is hand washing our hands for at least 20 seconds before and after seeing every patient. We use CaviWipes to disinfect every surface and autoclave every single instrument after every use. Also, we make sure to…
- As a nurse supervisor working in a infectious disease ward facility you must know the infection prevention and control measures to prevent cross contamination. How will you consider that you are an expert, applying Patricia Benner's Novice to Expert Theory. Elaborate your answer.What does BCR ABL positive mean?This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids