Q: How could you describe the process shown below? Farming reduces forest area Deforestation reduces ra...
A: By examining the above process it can be concluded that the terms Diverging process and Neutral proc...
Q: When does chromosomal nuclear DNA, which is found inside the nucleus of a eukaryotic cell, replicate...
A: The cell division involves production of new daughter cells from the mother cell. Different strategi...
Q: heart Love carries oxygenated blood from the lungs to the heart LOVU deoxygenated blood from the upp...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: How would you predict an evolutionary shift from horizontal to vertical transmission of a symbiont i...
A: In general, transmission of viruses can occur through two pathways: horizontal and vertical transmis...
Q: 1.The Philippines is a developing country and many of its areas are classified as geographically- is...
A: There are few points about parasite : we know that parasites are living on other body for food and ...
Q: Consider the equation below. What are its consequences in the context of an electrophoresis experime...
A: Electrophoresis is a technique used in laboratories to separate DNA, RNA, and protein molecules depe...
Q: One of the frist steps in isolating plasmid DNA via mini-prep is to pellet the cells after O/N cultu...
A: 1) The use of Resuspension buffer in the extraction or the isolation of the plasmid from the DNA is ...
Q: When did photosynthetic organisms first appeared? O From the very beginning of life, they are some o...
A: Photosynthetic creatures, also called photoautotrophs, are photosynthesis-capable organisms. Higher ...
Q: Explain the level of greenhouse gases in the atmosphere and its impacts in environments with a neat ...
A: Green house effect It is the phenomena where earth surface get heated. It is a natural process. when...
Q: How is mitochondrial DNA transmitted to children?
A: Q. How is mitochondrial DNA transmitted to children? Answer - mitochondrial DNA makes up 1% of Cellu...
Q: Explain : Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages
A: Vpr means viral protein R and it is a HIV gene and protein product. This gene is responsible for vi...
Q: 14. You are studying two strains of C. diptheriae and find that one strain is fully capable of causi...
A: Difference:- The difference between two strains of Corynebacterium diptheria, one of which can caus...
Q: In a short personal essay, what is the ultimate purpose of human life
A:
Q: Comprehensive explanation about how the species of finches , that were found by darwin at galapagos ...
A: Natural selection, according to Charles Darwin's theory of evolution, is how evolution occurs. Physi...
Q: What are the roles of ATP and NADPH in photosynthesis?
A: Photosynthesis is a process that plants and other living things use to convert light energy into che...
Q: Please match the Arthropod subphylum or class to the description. two pairs of antennae [ Choose ] [...
A: Arthropoda is a largest phylum in Animal kingdom.
Q: A B • Structure A [ Select] • Structure B [ Select] [ Select ] • Structure C is part of the endoskel...
A: A - is the stomach.( Star fish consists of 2 stomach the cardiac stomach and the pyloric stomach. B-...
Q: QUESTION 4 Which of the following is NOTa part of an inflammatory response? O Edema Histamine releas...
A: Inflammation: it is a natural immune response of the body against harmful agents. Inflammatory respo...
Q: What is genetic disorders? Explain by giving an example.
A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...
Q: Number of cycles 1 сycle Step Temperature Time Initial Denaturation 98°C 5 minutes Denaturation (a) ...
A: Polymerase Chain Reaction requires 5 most important aspects before starting with the protocol, these...
Q: How is UV exposure an example of phenotypic plasticity
A: The ability of a genotype to express different phenotypes depending on its environment is referred t...
Q: QUESTION 1 Vaccination increases the number of: different receptors that can recognize a pathogen ep...
A: The term vaccination is associated with the action responsible for stimulating the human body’s acti...
Q: What do you think would happen if you tried to view a slide using the oil immersion lens but forgot ...
A: Q. What do you think would happen if you tried to view a slide using the oil immersion lens but forg...
Q: Why is it important to grossly check a stool sample in a clinical parasitology laboratory?
A: Stool samples are often analysed when there are infections and diseases of the gastrointestinal trac...
Q: What is the purpose of an autoclave and what is its mechanism?
A: Answer :- An autoclave is utilized in clinical and research facility settings to disinfect lab hardw...
Q: Which of the following are not used for mechanical digestion? A. Pancreatic juice B. Saliva C. Bile ...
A: F- none of the above. Mechanical digestion involve mastication however chemical digestion involved ...
Q: How could multi-genes families complicate things in terms of using CRISPR to knock out a target gene...
A: Human body is a complex inter relation of all the biochemical and genetci expression. In a multi gen...
Q: 8. In which of these clades (Deuterostomia, Lophotrochozoa, Ecdysozoa, Porifera, and Cnidaria) would...
A: Your answer has strating in step 2. Step 2 image is made by me, in MS word. This image not copied fr...
Q: The transcription of many bacterial genes relies on functional groups called operons, such as the tr...
A: Turning/switching genes on and off is referred to as gene regulation. Cells start to take on special...
Q: What is done when there is a delay of stool examination
A: Stool specimens can be examined fresh or preserved , if there's delay in Stool examination it should...
Q: Examine your environment or near local ecosystem and look for the species having variation in appear...
A: Variation among the species reduce competition for food even living in a same habitat which eventual...
Q: Suppose a genetically engineered fish escapes into the wild, what do you think would be the implicat...
A: If genetically engineered fish will enter a world where wild salmon are already in a precarious sta...
Q: What are terpenes? 2. Essential function of terpenes in plants? 3. What is the difference between te...
A: The secondary metabolites in plants helps in defence and communication. The secondary metabolites ar...
Q: outline the use, description, history, and functionality of a compound light microscope
A: Description of Compound Microscopes:- A compound microscope is an upright microscope that uses two ...
Q: What types of gametes are formed by the following genotypes? All gene pairs are segregating independ...
A: Alleles are the alternative forms of genes that are located on the same locus of a homologous chromo...
Q: What are the functions of the cardiovascular system?
A: The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is t...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: What is the purpose of the Kreb's Bicycle in nitrogen metabolism? Include in your description where ...
A: Introduction: The reactions which help in converting pyruvic acid to carbon dioxide and water in mit...
Q: What are some challenges still today about reproductive cloning
A:
Q: How does the insect circulatory system carry out physiological insect defence mechanisms? Is there a...
A: The circulatory system present in insects differ from the circulatory system found in human body. An...
Q: Myoglobin is a carbohydrate which in normally found in muscle tissue. True False Chromatin is compos...
A: It specifies a single polypeptide chain with one oxygen binding site. Myoglobin has a heme prostheti...
Q: A hand-drawn PCR diagram to show the role of each component and relevance of each temperature shift ...
A: Polymerase chain reaction (PCR) was first invented by Mullis in 1983. Its principle is based on the ...
Q: What is the virulence factor of Mycobacterium tuberculosis
A: Virulence factors are specific molecules of pathogenic organisms that cause the invasion against the...
Q: Explain Biochemical Evidences. How can it support evolution
A: Introduction :- In biology, evolution refers to the change in a species' features over numerous gene...
Q: Suppose a person with the dominate blood form and a person with the other dominate blood form type g...
A:
Q: 3. Construct a pedigree chart by following the information given below. A man who is heterozygous fo...
A: The constructed pedigree along with genotypes are attached below. "a" allele carries the trait.
Q: Write the word TRUE if the statement is correct and if not, underline the word or statement that mak...
A: Introduction:- 1. The first genetically modified organism to be created was a bacterium, in 1973. S...
Q: How are these examples of phenotypic plasticity? 1. Haman weight 2. UV exposure 3. Flower color/pH
A: Answer :- 1. Human weight :- Phenotype is the noticeable physical or biochemical qualities of a in...
Q: You discover a species in which most individuals display a diploid number of 28. However, you alsa n...
A: Haploid is the condition in which a cell has a single set of chromosomes. Triploid is the condition...
Q: Cross C: Homozygote wild type flies (+/+) were crossed with white eye flies. for the F1 and F2 gener...
A:
What do you call the movement in which the yolk plug is formed in amphibians?
Step by step
Solved in 2 steps
- Describe the pre-gastrulation morphogenesis found in Amphibian development.Describe the step-by-step fertilization process in an amphibian. Include in the discussion the structures involved in the process.In the early stages of amphibian development, what layer is involved in yolk digestion? What is the basis for the distinction between germ layers in gastrulation? (min. 5 sentences)
- What are the roles of the chorion and amnion in terrestrial vertebrate embryos?Identify the significance of gastrulation in the developmental process and compare gastrulation in the echinoderm (or in amphioxus), the amphibian, and the bird.Using sea star embryos as an example, describe gastrulation. Explain how the mass of inert yolk affects gastrulation in frog and bird embryos
- In amphibian gastrulation, are there any evidences of cephalization? Why or why not? (min. 5 sentences)What is the fate of the four extraembryonic membranes in embryos of placental mammals?describe early development in amphibians, including the processes of cleavage, blastula formation, and organogenesis?