What conclusions can Melia and Sophie make about their phage Zucchinibread from this experiment?

Q: In the name E. coli 4X5B, which part is called the serotype, serovar, or strain?     E     coli…

A: A microbe is a living entity that is so tiny that it cannot be seen with the naked eye. Microbiology…

Q: Corn has been genetically engineered to produce the anti-insect poison of a bacterium Bacillus…

A: Bacillus thuringiensis (Bt) is a species of bacteria that lives in soil. It produces toxic proteins…

Q: Can you show me the step how you get the amino acid sequence?

A: An amino acid sequence refers to the linear arrangement of amino acids in a protein or peptide.…

Q: How many genes Haemophilus influenzae (the first bacterial genome sequenced) ?

A: Haemophilus influenzae  is the first bacterium whose genome has been sequenced. It was sequenced via…

Q: Why production of a human protein in bacteria by genetic engineering is possible?

A: Step 1 The origin of modern biotechnology is based on two core techniques of genetic and chemical…

Q: What is the role of euglenoids and its dagram?

A: Simple divisions of organisms includes only plants and animals. The animal are further divided into…

Q: What results would you expect if the bacteriophage that Hershey and Chase used in their experiment…

A: Alfred Hershey and Martha Chase conducted an experiment and concluded that DNA is the genetic…

Q: How many millions of bases are in the genome of the mimivirus or largest virus known?

A: In the family Mimiviridae, the genus Mimivirus contains enormous viruses. Their native hosts are…

Q: How could transposons be used in the study of bacterial genetics

A: Transposition is a method of translocation of small DNA segment from one location called donor site…

Q: what is amgen and what is their purpose?

A: Pharmaceutics is the study and production of drugs and remedies by governmental and private…

Q: How was it determined that DNA resides in the nucleus of eukaryotic cells?

A: Cell is the structural and functional unit of life. The cell forms the basis of life. Inside the…

Q: What is mutation in yeast?

A: Yeast is a eukaryotic unicellular organism that belongs to the kingdom Fungi. These organisms are…

Q: s th

A: Answer-- Meselson and Stahl experiment use N15 in E.coli by density gradient centrifugation.This…

Q: In your laboratory, you have an F − strain of E. coli that is resistant to streptomycin and is…

A: Conjugation is the transfer of genetic material from one bacterium to another bacterium. Here, a…

Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…

A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…

Q: What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction…

A: Thermus aquaticus is a heat tolerant bacterium .DNA polymerase used from Thermus aquaticus is heat…

Q: What experiment was done with mice and their faeces?

A: Mice are used in the laboratory for research work due to their similarity with humans. They are…

Q: A+G G C+T || ||

A: Allan Maxam and Walter Gilbert introduced Maxam–Gilbert sequencing in 1976–1977. The method involves…

Q: methionine, just in case your yeast happens upon circumstances where it can’t eat methionine. It…

A: To answer your first question:-  Take an instance where your mother has already cooked food for you…

Q: Is the yeast strain HA0-1 complementary to HB1 or HB2?Explain.

A: Complementation analysis is generally analysed to identify the mutations in yeast through adenine…

Q: Why do eukaryotic cells do not contain restriction enzymes?

A: Restriction enzymes are used extensively in molecular biology to cut DNA. One of the unique features…

Q: How can one clone bacteria

A: Cloning is the process where we can create or generating a exact genetic replica or copy of another…

Q: What are pseudoalleles? Please give examples and explanations.

A: Introduction Alleles:- An allele is one of two or more versions of a gene, It denotes the variant of…

Q: al RNA used to identify a new b

A: RNA stands for the ribonucleic acids. It is a molecules that is similar to DNA as it is also act as…

Q: why do we use EcoRI plus HindIII rather than BamHI or Sau3AI?

A: Restriction enzymes are enzymes that cut DNA at specific recognition sites. These enzymes are used…

Q: Why is bacterial conjugation important?

A: Transfer of genes in prokaryotes occurs through horizontal gene transfer mechanisms like…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: An auxotroph bacterium A could grow only on a medium containing leucine, and an auxotroph bacterium…

A: Auxotrophs are the mutant strain which are not able to grow on minimal media. Such mutant strains…

Q: What were the initial experiments performed to determine the steps which elucidated the central…

A: a) During expression of a protein-coding gene, information flows from DNA→ RNA→protein. This…

Q: What do you think will happen if we ran digested yeast genomic DNA on an agarose gel???

A: The yeast genome is approximately 12 Mb, organized in 16 chromosomes.

Q: Who discovered conjugation in bacteria?

A: Conjugation in bacteria is a method by which bacteria exchange genetic material through direct…

Q: Do bacteria require telomerase? Explain why or why not

A: No, Bacteria do not require telomerase.

Q: Where did western blot get its name?

A: The western blot (also known as the protein immunoblot) or western blotting is molecular biology and…

Q: What are Hfr-strains? Why were they useful in the early days of bacterial genetics?

A: Horizontal gene transfer is the process of transferring genetic material from one organism to…

Abiogenesis