What are the MOST common sources of glucose needed for energy during exercise? A. Blood sugar and glycogen stored in muscles B. Breakdown of absorbed proteins C. Breakdown of fatty acids stored in adipose tissue D. Vitmains, minerals, and amino acids from nutritional supplments

Q: What is the difference between Rho Dependent and Rho Independent termination in prokaryotes?

A: Transcription is the process of synthesis of transcript (mRNA).  It occurs unidirectionally in 5'…

Q: 1. early diagnosis of diseases 2. preventing potential threat of unfavorable environmental…

A: Tertiary prevention aims to lessen the effect of existing disease by removing or lowering…

Q: Which of the following is NOT a recommended method for preventing cross-contamination? A. Washing…

A: Cross contamination  Cross contamination is physical transfer or movement of pathogens from one…

Q: The thick filament is composed almost entirely of _____ molecules. (This is a multiple choice…

A: Each organized skeletal muscle in our body is made up of a number of muscle bundles or fascicles ,…

Q: Describe the relationship between the template strand of DNA, the codons inmRNA, anticodons in tRNA,…

A: Introduction:- The process of copying genetic information from one strand of DNA into RNA is termed…

Q: Choose TWO of the cell structures from the list provided. Explain the general appearance of each…

A: Cell  It is the basic fundamental entity of life. Cell make all life possible except viruses.

Q: INDICES OF THE MICROCLIMATE OF PREMISES 1. the content in the air of carbon dioxide and…

A: "Climate" is the average temperature, amount of water vapor, and amount of rainfall that has lasted…

Q: Explain delayed type hypersensitivity (DTH). How might you expect to induce it? What components of…

A: The delayed type hypersensitivity (DTH) is characterized by the T cells recruitment into tissues to…

Q: Animal phylogenies based on molecular and

A: 1) Phylogenetic trees basically reconstructed from different genes in the same organism. However it…

Q: Why does fertilization always occur in a fluid medium in nature?

A: Fertilization is defined as the union of two haploid gametes, the spermatozoa and the oocyte, herein…

Q: 1. penetrates deep into the tissue, but without the subjective sensation of heat and burning of the…

A: Infrared radiation is emitted from the sun and fire and radiation can be sensed as a warm feeling on…

Q: 1. Identify cach pedigree in a and b as sutosomal recessive or autosomal dominant. Write all the…

A: Pedigree study helps us to understand the mode of inheritance of a particular disease by observing…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: What evidence is there for the hypothesis that life originated on Earth by the creation and…

A: The origin of life on the earth is both an interesting and a difficult question to answer. We have a…

Q: Explain the role of Ras.GTP and Rac.GTP in the formation of active AP-1 during T- cell activation.

A: T cells are produced in the thymus and are primed to recognize a certain foreign particle (antigen).…

Q: 16.In what order do sperm move through the structures of the female reproductive tract? (This is a…

A: Reproductive System: The biological system of an organism's reproductive system, also known as the…

Q: 7) The protein VEGF plays an important role in stimulating the formation of new blood vessels. In…

A: VEGF ( vascular endothelial growth factor ) is responsible for the growth of new vessels. In…

Q: Which statement about cellular aging is TRUE? Cellular aging is unrelated to the first law of…

A: Answer :- Option (C) is correct. - Cellular aging is the result of an intracellular accumulation of…

Q: Describe Class II MHC pathway of antigen processing with the help of a diagram.

A:

Q: The cochlear apex is: Not associated with a topographical mapping of frequency Where the helicotrema…

A: Option C is the correct answer.Explanation: Hair cells have cochlear nerve which contains axons and…

Q: What is photosynthesis

A: Plant cell and animal cell differ in many aspects. One of these is presence of chloroplast in the…

Q: Which of the following is NOT a stock form of the key molecules for energy generation in muscle? A.…

A: Adenosine triphosphate (ATP) is used to generate energy in muscles. A significant amount of ATP is…

Q: Which statements are true? Explain why or why not.1 The different cells in your body rarely…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA…

Q: An outdoor breeder of exotic pheasants in Athens, GA notices that eggshell quality deteriorates for…

A: In annelids, extraembryonic membranes are thin protective mucosal tissue that forms on the fetus's…

Q: Which of the following does NOT contribute to the longer lasting and more widespread effects…

A: Sympathetic System:  Along with the parasympathetic nervous system, the sympathetic nervous system…

Q: Which of the following is NOT true about the Charophycean green algae? a. They generally have…

A: Anatomy, which reveals that evolutionary ties may be proven through homologous structures, and…

Q: i need the answer quickly

A: The heat transfer method is divided into three types: conduction, convection, and radiation. Heat is…

Q: 1. Skunk cabbage has evolved stinky flowers because (a) the smell prevents other plants from growing…

A: Introduction Plants and other organisms use photosynthesis to transform light energy into chemical…

Q: Design a simple experiment testing for the effect of cold temperature on poppy seed germination.…

A: A cold germination test evaluates a seed lot's emergence in cold, wet soils, which might result in…

Q: There are 10 E. coli cells in a test tube.  After 4 generations in exponential phase, how many E.…

A: A growing bacterial population doubles at regular intervals. Thus, the E. coli cells grows in a…

Q: record the results for the slant and butt of the Kligler's Iron Agar tube for shigella spp

A: Introduction Carbohydrate fermentation is detected using Kligler's Iron Agar (KIA). The KIA reaction…

Q: The site of post-translational cleavage of biologically active proteins is often ma O methylated…

A: Protein post-translational modifications (PTMs) increase the functional diversity of the proteome by…

Q: The cells that are found in tendons are called: A. osteocytes B. adipocytes C. haemocytoblasts D.…

A: Introduction - A tendon is a strong, flexible tissue cord that looks like a rope. Tendons are the…

Q: Is biotechnology always associated with genetic engineering? Explain your answer

A: Biology is a vast area which is divided into many sub branches such as Biotechnology, Biochemistry,…

Q: Patients with DiGeorge syndrome may fail to produce IgG in response to immunization with T-dependent…

A: Introduction:- DiGeorge Syndrome is a primary immunodeficiency disorder characterised by aberrant…

Q: In toddlers, a higher fiber diet can? A. Enhance the absorption of iron and zinc B. Result in…

A: Fiber alongside with liquid intake moves rapidly and generally effectively through your…

Q: Name the phases of the cell cycle.  b) During which phases are the chromosomes and then the…

A: Cell cycle  Cell cycle is a division of cell takes place in various steps and divide one cell into…

Q: B D.

A: The cochlea is a hollowed, spiral-shaped bone in the eardrum which plays a significant role in…

Q: We know in detail about many cellprocesses, such as DNA replicationand transcription and RNA…

A: Introduction  A cell is a cytoplasmic mass that is externally attached by a cell membrane. Cells are…

Q: Which of the following statements does NOT agree with the tenets of Darwin's theory of evolution by…

A: Darwin's influential and contentious book On the Origin of Species was published in the 1850s. He…

Q: Different hypersensitive responses can result from a bee sting. What type of hypersensitivity could…

A: i) This case is of hypersensitivity type 1 as the effect disappears within an hour and does not get…

Q: The pituitary gland is often referred to as the master gland. Set aside the fact that this term is…

A: The pituitary gland is a peanut-sized gland situated at the bottom of the brain in a bony structure…

Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: metamorphosis of insect

A: The transformation of an immature insect from a larva to a pupa to an adult through out their life…

Q: Fadi was diagnosed of having chronic stress due the bad economic and political situations in…

A: The common cold is caused by viral infection. People under severe stress are more likely to catch a…

Q: Q1. Science can be conducted using experiments or by observation. In both cases, one can deduce…

A: Observation is a vital piece of science. It allows us to see the aftereffects of an experiment,…

Q: Each enzyme is able to promote only one type of chemical reaction. The compounds on which the enzyme…

A: A. Temperature- The rate of an enzyme-catalyzed reaction rises as the temperature rises, as it does…

Q: Your patient has been poisoned by an unknown substance and shows signs of delirium, abnormal heart…

A: Introduction When an organism is exposed to a sufficient amount of poison, it can cause death,…

Q: Photoreceptor synapses with bipolar cells: O respond to depolarization and hyperpolarization of…

A: Photoreceptors synapse with bipolar cells and respond to depolarization and hyperpolarization of…

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.