Q: Which of the following is an environmental factor that leads to food insecurity? a) Poverty b)…
A: Food insecurity defines the conditions when there is an inadequate amount of food they consume (in…
Q: retort pouch is: a) Filled first with food product and then retorted (heat-sterilization) to extend…
A: In retort pouch food is filled into a pouch . Then it sealed and next heated to extremely high…
Q: septic shock is a life -threateningcondition caused by an overwhelming A inflammatory…
A: C. most suitable answer is.. Failure of blood clotting cascade.
Q: DNA photolyase- strain of E. coli
A: Photolyase is an enzyme that repairs DNA that has been damaged by ultraviolet light. These…
Q: ´A D. E В Coronal Suture [ Choose ] Supraorbital Torus [ Choose ] Mastoid Process [ Choose ] Mental…
A: In vertebrates, the cranium is a bony structure that creates the head. It creates a safe chamber for…
Q: in 250 words and in own words Explain the role of the components of a spinal reflex arc.250 words…
A: A reflex arc is defined as a neural pathway that controls a reflex. The usual pathway would have…
Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…
A: ATP is the currency of the cell and it starts with glycolysis. Glycolysis is the breakdown of…
Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…
A: BLAST stands for Basic Local Alignment Search Tool (BLAST) This is helpful in finding location of…
Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…
A: Answer :- Option (C) is correct. - Insulin receptor phosphorylation increases insulin secretion.
Q: In the DNA of any individual human, about 300 mutations may differentiate the genome from either…
A: Introduction Gene:- A gene is the basic physical and functional unit of heredity. It is a part of…
Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…
A: The genetic code can be defined as a set of specific rules for a living cell to translate…
Q: Why would vaccination be more likely to eradicate a viral disease than a bacterial disease? Why can…
A: The last case of Smallpox happened in 1977. Edward Jenner first introduced vaccine of Small pox.…
Q: The fact that muscles and skeletons work together to move the body from place to place is an example…
A: Living organisms exhibit life processes that are absent in nonliving objects.
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…
A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…
Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…
A: Induction is the process by which the presence of one tissue influences the development of others.…
Q: Observation
A: The monosomies , trisomies and other type of chromosomal abnormalities mainly affects the chromosome…
Q: During activation, there is a secondary exchange of signals between the presenting cell & activated…
A: During activation , there is a secondary exchange of signal between presenting cell and…
Q: What is corpus luteum. How does it function as an endocrine gland?.
A: Introduction :- During the ovulatory phase, when an ovarian follicle releases an egg, the opened…
Q: Solve in digital format to be able to pass it to word Look at the following scheme: why we say that…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.
A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…
Q: Write down the levels of ecosystem organization from smallest to largest, next to its' description.…
A: We will answer the first question as the single question is not specified. Please specify the…
Q: How does we know that trees or plants are transpiring base on your experiment?
A: The physiological process by which water is lost in the form of vapour from the living tissues of…
Q: You have cloned the protein coding region of the porin gene from a phage into a bacterial cell for a…
A: Generally the phage viruses don't have a transcription or replication machinery they are dependent…
Q: Question 16 The fact that some eukaryotic FRNAS are self-splicing indicates that (A RNA can contain…
A: Nucleus is main controller of the cell which possess genetic information . It also contain long…
Q: In your words explain passive transport by osmosis using isotonic, hypertonic, and hypotonic in both…
A: Osmosis It is passive transport. In this type of transport, the water moves across the semipermeable…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: A. Complete the table below by filling in the information you have learned from the concept on the…
A: There are two primary processes associated with the gene expression. Gene expression refers to the…
Q: how the genes are related to intellectual disability in details
A: Answer :- As we know that incorporates Fragile X disorder (FXS), the most well-known acquired type…
Q: Question 4 of 25 Use the diagram to answer the question. Some organisms use a single loop…
A: The single loop heart is found in lower organisms (fish), in which the blood pressure and oxygen…
Q: Draw the keto or enol tautomer for each of the following compounds when they were treated with…
A: 1. Propanol on being treated with traces of acids or bases, its structure is converted to Propanone.…
Q: which of these is characteristic of gram positive, gram negative bacteria or mycobacteria have a…
A: Bacteria are microscopic prokaryotic ubiquitous organism which do not have nucleus nor membrane…
Q: Explain in detail the process of making beer with process flow diagram.
A:
Q: Label the diagram below using the drop down menu provided.
A: The stem of both monocots contains vascular bundles that are made up of xylem and phloem tissues.…
Q: When present, the TATA, CAAT and GC boxes are typically found within 100 - 150 bp upstream from the…
A: The TATA box is a conserved nucleotide sequence located around 25-30 base pairs upstream of the…
Q: What are the principle and basic concepts of NEGATIVE staining?
A: Introduction Staining is a technique for enhancing contrast in material, usually on a microscopic…
Q: F E D H 1-09 G H life cycle life cycle A C B
A: Virus is a minute entity just like other microbe but have small size. It has dua nature . It behave…
Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%. If the…
A: The genotype of the population is a number of populations with the given genotype and is calculated…
Q: Compare and contrast the sensory and motor mechanisms between plants and animals using a Venn…
A: Motor is a muscle, nerve or centre that effects or produces movement. Sensory is light, smell,…
Q: QUESTION 15 Which of the following does not change gene frequencies in populations? selection O…
A: Introduction :- The relative frequency of an allele (gene variant) at a specific locus in a…
Q: does chain abberation due to translocation mutation result to fertile gametes
A: Translocation is a structural change in the chromosome and includes the exchange of chromatin…
Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…
A: The regulation of concentration of body fluids is called as osmoregulation. • The plants absorb…
Q: Describe the enzymatic reaction of the protein epidermal growth factor. Include the specific…
A: Epidermal growth factor is a protein, involved in cell cell proliferation and differentiation, by…
Q: What volume of 10X TBE buffer should you use to make 100mL of 1X TBE buffer? 10mL 1mL 0.1mL 100mL
A: TBE buffer stands for Tris-Borate-EDTA buffer. It is used for both agarose and polyacrylamide gel…
Q: You are studying the process of oxidative phosphorylation in the lab. You isolate several…
A: Mitochondria is also known as the powerhouse of the cell.
Q: Which of the following mutations in the Gas subunit of the GPCR pathway for glycogen breakdown in…
A: GPCRs are a large family of cell surface receptors that respond to a variety of external signals.…
Q: explain why biodiversity is the life insurance of itself?
A: Biodiversity- Biodiversity is the biological variety and variability of life on Earth.
Q: Describe the process of Translation of mRNA to DNA.
A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…
Q: What is human Intelligence?
A: The ability of human brain or mental quality is basically the human intelligence. It includes the…
Q: Match the evidence of evolution with its description: f Comparative Anatomy a. structures that don't…
A: Comparative anatomy - comparin strucrures to show species has shared ancestry. Homologous organ -…
What are the environmental climatic and bio-physical requirements of lowland rice
Step by step
Solved in 2 steps
- WHAT ARE THE SOIL FERTILITY ISSUES WHICH ARE LIMITING FACTORS OF SUCCESSFUL CROP PRODUCTIONWhy do pasture grasses continue growing despite being grazed upon by animals and why do lawn grasses continue growing despite being trimmed regularly? *Plants vary widely in how they allocate biomass to roots, leaves and stems. Two key measures of plant allocation in an ecosystem context are leaf area index (LAI) and the root to shoot ratio. a) Define each of these measures and discuss how variation in each measure can influence net primary production (NPP). b) Pick one of the measures and discuss how and why you would expect it to vary in relation to an abiotic factor of your choice. Underline the abiotic factor you choose.
- Describe how the following external factors affect tiller production in vegetative grasses. 1. Moisture availability 2. Plant competition 3. Herbage removal.What is the fundamental difference between energy flow and nutrient fluxWhat are the nutrient contents of the prepared bio fertilizer? What is the biopesticidal substance present in the prepared biopesticides?
- What are the costs and benefits of clear-cutting versus selective cutting when harvesting trees?Draw the NPK economy by showing how these nutrients are being added and lost in the soil system (Just a simple illustration-Boxes and Arrows with labels/descriptions - is enough to illustrate the soil nutrient economy) Each of the soil nutrient, N-P-K, should have a separate hand-drawings. Thus, there will be three (3) drawings.Fertile soil is one of the keys to good yield. (i) Explain the roles of clay and organic matter in contributing to soil fertility and cation exchange capacity (CEC). (ii) Name ONE (1) negative effect of low CEC and high CEC soils respectively. Suggest ways to improve low CEC and high CEC soils. (iii) Suggest ONE (1) suitable type of crops for high CEC soil, low CEC soil and loam soil respectively.
- What major cash crop is grown in shade to produce large thin leaves?What is expected price per hectare at harvesting time of beetroot produced in 1 hectare?A genetically modified corn crop that is resistant to the herbicide glyphosate ("Round-Up") may contribute to conservation agriculture practices because: O The plants would thrive with less water, so they would not need to be irrigated as frequently. O It is not possible for any other organisms, such as weeds, to develop a resistance to glyphosate. O The plants would be resistant to pests, such as the corn borer, so would not need to be treated with pesticides. O All of these answer choices are correct. Because they could be sprayed with glyphosate, the soil would not require tilling to control weeds. Not saved Submit Quiz MacBook Pro