Compare and contrast the sensory and motor mechanisms between plants and animals using a Venn diagram

Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…

A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…

Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…

A: Mimicry refers to the superficial resemblance of two or more organisms that are not closely related.…

Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.

A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…

Q: Briefly explain the following concepts in relation to delivery and assessment strategies, for each…

A: The qualifications and related units of competency that need to be completed customise for each…

Q: What are initiatives that have to be done lower your household’s vulnerability to climate change

A: Environmental change drives have huge scope efforts to battle an Earth's global warming temperature…

Q: primer

A: PCR- it stands for the polymerase chain reaction. it is used to make many copies of a specific…

Q: 4. The diagram illustrates the activity of vesicles during a cellular process. Which statement best…

A: Golgi body use to release the vesicles which contain the material of the cell. The main function of…

Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?

A: Answer--

Q: Based on today’s science and medicine, when does the age of viability begin? a. between 8 and 12…

A: The viability of a fetus indicates that the fetus has a survival chance. As soon as the fetus…

Q: Describe all of the ways in which RNA is modified after transcription in eukaryotic cells

A: Transcription of creating RNA from a template of DNA. It can be found in the nucleus of eukaryotes.…

Q: Specialist species can eat a variety of foods and have broad niches O be vulnerable to extinction…

A: Specialist Species can be vulnerable to extinction when environment changes because they have narrow…

Q: Essay on Circulatory system

A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which…

Q: Change in gene frequencies within a reproductive population is called: O allopatric speciation. O…

A: Evolution is defined as a change in the inheritable traits of biological populations, over multiple…

Q: Describe not just list 4 adaptations that allow plants to cope with these challenges, 2 for coping…

A: The transition of plants from water to land Liverworts are believed to be the first plants that…

Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).

A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…

Q: Distinguish between positive and negative control. Give examples of each from the lac operon

A: Operator is a unit consisting of one or more cistrons that function coordinately under the control…

Q: What is biomass

A: Biomass is defined as the total quantity of plants in a particular area.

Q: what is a creation myth? why is knowing the creation myths important

A: What is creation myth-  A creation myth is the narrative about how people came to inhabit and how…

Q: Identify two problems associated with genetically modified organisms.

A: A genetically modified organism (GMO) is a living organism whose DNA has been altered via the use of…

Q: Macroevolution deals with the evolution of new species that takes place over long periods of time…

A: Macroevolution is a word that relates to evolution that occurs above the level of a single species.…

Q: What does the color of Leo’s urine tell you about how concentrated or diluted it is? What about his…

A: 1.Before exercise leo is well hydrated because his urine color is pale yellow this is also supported…

Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…

A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…

Q: What are some general similarities in how receptive fields are represented by the nervous system?…

A: Receptive field is a region in the sensory periphery within which stimuli can influence the…

Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…

A: Introduction An electron transport chain is a collection of protein complexes and other molecules…

Q: Describe the differences between 'top down' and 'bottom up' proteomics? Under which conditions would…

A: Proteomics has large scale investigation for proteins. Proteins are important portions of living…

Q: Which of the following is not true about a gram-positive cell wall? It has plasma membrane inside…

A: Introduction :- The Gram-positive cell wall is made up of many interconnected peptidoglycan layers…

Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…

A: This question is about gene.

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Cellular respiration, like burning, results in the complete oxidation of glucose into CO2 and water.…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…

A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…

Q: Protein N, normally inactivates a tumor suppressor protein. Consider a cell with a mutation in one…

A: For tumour suppressor gene to be purely dysfunctional and leading to neoplastic genes, there need to…

Q: Name and describe the main fuctional macromolecule found in red blood cells

A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…

Q: Briefly explain the generation and conduction of nerve impulse.

A: Introduction Neurons:-  It is the structural and functional units of the nervous system of humans…

Q: Label feedback loop of body fluid homeostasis: kidney anatomy (stimulus, sensor, response, set…

A: The kidneys filter the blood on a regular basis to maintain the body's fluid and electrolyte…

Q: LDL LDLR LDLR LDLR ( Which mouse has higher blood cholesterol between mice in lanes 1 and 2?…

A: Western blot : It is a technique used to identify and locate proteins based on their ability to…

Q: You are working with a bacterial lysogen and have decided to induce lysis. What needs to happen for…

A: Viruses are an obligate intracellular parasites. Some viruses are temperate phages that have to…

Q: 13 15 DSS karyotic organisms that cause infections eases that can't be caught (passed from person to…

A: Disease is a state of illness which could be contagious that is spread from person to person or…

Q: A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in the diagram…

A: In its broadest definition, a haplotype is a collection of DNA changes along a chromosome that tend…

Q: The students of a Microbiology class were tasked to transfer or subculture a pure culture of…

A:

Q: Septic shock is life - threatening condition caused by an overwhelming

A: Septic shock- it is a condition sometimes occurs  in severe sepsis, in which the blood pressure…

Q: 2. An ecologist spent a year studying the population dynamics of a species of duck on a lake. At the…

A: Introduction Migration, in ecology, is the seasonal movement of animals from one habitat to another…

Q: Who was the first to observe microorganisms with a microscope? Crick Pasteur Koch Van Leeuwenhoek…

A: organism that can only be seen under a microscope Bacteria, protozoa, algae, and fungi are examples…

Q: (a). What is the role of calcium ions and troponin during contraction in striated muscles of hum

A: Introduction - Myofibrils, which contain a specialised protein (myoglobin) and chemicals to deliver…

Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…

A: Induction is the process by which the presence of one tissue influences the development of others.…

Q: 15. Coupling Redox reactions The top reaction was left out of the table. It is: 1/2O2 + 2H+ H₂O E'o…

A: Equation  ΔGo = -nFEo ΔGo = Standard Gibbs energy n= electrons transferred F = Faraday's constant…

Q: Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles Ostriches Feathers…

A: In biology, evolution refers to the change in a species' features over numerous generations as a…

Q: Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the…

A: Primase is an RNA polymerase that requires ssDNA to make RNA primers during DNA replication.

Q: Go-Bags are used primarily during natural disasters. Can you give some situations a Go-Bag would…

A: Introduction A go-bag is a bag filled with necessary supplies that can be used in the event of a…

Q: To completely unfold a globular protein, use both A denaturant and reducing agent b smooth…

A: Spherical ("globe-like") proteins, also known as globular proteins or spheroproteins, are one of the…

Plant sensory system

The plant sensory system is a sophisticated system that responds to environmental stimuli such as light,temperature, gravity, and touch. Research predicts that plant hormones and signaling mechanisms areresponsible for this regulation system in plants.