What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…

A: DNA replication being very complex process, there are chances of miss reading the DNA template and…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…

A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: Aspartate and phenyalanine become apartate and isoleucine

A:

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: what amino acid is coded for by the codon 5AAG3?

A: Proteins are constructed from amino acids. Each amino acid is made up of a carboxyl group and an…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys?  (Note:…

A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: Write a possible mRNA sequence that could code for each peptide. Note: Reference the Genetic code…

A: To provide the mRNA sequence for each of the given amino acid peptide, we will be using the Genetic…

Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…

A: Gene expression is the process by which the instructions in the DNA are converted to functional…

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG.…

A: Given,Original Codon Sequence: AUGACCCGGCUACUGMutant Codon Sequence: AUGACCCGGUUACUGOriginal Protein…

Q: what amino acid is coded for by the codon 5AAG3?

A: Genetic code is written in a linear form using the ribonucleotide bases that compose mRNA molecule…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: What would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC?

A: The process of translation is essentially reading the message sent from DNA in the form of mRNA by…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: What type of mutation is shown in the diagram?   Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…

A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Give the single letter translation for the protein encoded by this mRNA. Start with the start codon.…

A: DNA is the genetic material of the organisms which by the process of transcription forms mRNA. This…

Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the…

A: Dystrophin is a protein that helps keep muscle cells intact.

Q: What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA

A: Gene expression is the process through which data from a gene is employed in the synthesis of a…

Q: What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using…

A: Gene expression is the process through which the genetic codes of a gene, the nucleotide sequence,…

Q: The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences…

A: Gene expression is the process by which information from a gene is used for synthesizing of a…

Q: I only need letter D and E

A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…

Q: Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would…

A: The objective of the question is to determine the sequence of amino acids that would result from the…

Q: Determine which amino acid is formed from the following mRNA codon: GUA.     a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: Second letter C UUU Phe UCU) UCC UGU UAU1 Tyr UAC S U UUC U UUA L UUG J Ser UGCCYS UAA Stop UGA Stop…

A: tRNA is an amino acid acceptor which carries the amino acid corresponding to the code present in the…

Q: If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu…

A: Introduction  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Suppose that a protein has the amino acid sequence…

A: Researchers need to take the degeneracy of the genome's code into account to calculate the amount of…

Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…

A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.