We have the following DNA sequence that codes for 7 amino acids of exon 1 of the dopamine receptor gene. 5’- GTG CAC CTG ACT CCT GAG AAG -3’ a. Obtain the sequence of the complementary strand to said DNA sequence: b. Obtain the sequence of the messenger RNA and indicate which direction it leads: c. Using the genetic code obtain the protein sequence: d). What effect would it have on the cells, in terms of their receptor for dopamine, if there was a stop codon in the third position in that mRNA sequence?

Q: Which of the following is incorrect? a. Protease inhibitors are small proteins that pose as protease…

A: Proteases are enzymes that can cause the hydrolysis of peptide bonds and can thus cleave the protein…

Q: association of 2alpha and 2 beta chains to form adult hemoglobin     identify which describes the…

A: Translation is process of conversion of RNA to protein.

Q: Define the following terms:a. SRPb. transloconc. docking proteind. SRP receptor proteine. signal…

A: Introduction: Proteins are biomolecules that consist of long chains of amino acids. The structure of…

Q: targeting a protein for the ER

A: The production of proteins for getting into the endoplasmic reticulum (ER) is started on the free…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Select the best explanation of the unfolded protein response (UPR): O A. The UPR senses misfolded…

A: When the protein is completely formed it is folded accordingly yo form a biologically active protein…

Q: The amount of this in the cell rises as DNA synthesis begins. Cis-acting element that can increase…

A: Step 1: Step 2:Step 3: Step 4:

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: synaptic knobs of a nueron have what function? a. they release neurotransmitter into the synaptic…

A: The nervous system is the specialized system that controls the sensory and motor activity in the…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: Match the following proteins to their functions ✓ Cathepsins ✓ Calpains ✓ Granzyme B ✓ Apoptosis…

A: Introduction A rectilinear chain of amino acids joined by peptide bonds constitutes a protein.…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…

A: Introduction Pancreas is a holocrine gland present in our body. It has both endocrine and exocrine…

Q: 1. Construct one plot including the data for the WT and the MC4R mutants presenting the differences…

A: A G protein-coupled receptor (GPCR) helps control how much energy we have. The hormone called MC4R…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: a. the receptor/s b. the energy source c. if there is signal peptide cleavage or none Peroxisome:…

A: The components of amino acids are alpha carbon at the core, hydrogen (H), amino (-NH2), and carboxyl…

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: 1. The SRP is recognized by the SRP receptor. 2. The ribosome translates the protein through the…

A: NOTE- as per our bartleby guidelines we are not allowed to answer more than one question at a time…

Q: Select from the drop-down menu which type of regulation is occurring in each case. The Ixb12 gene…

A: Gene regulation is a mechanism of controlling the function of gene and it's associated mRNA and…

Q: 1. The following image shows a mechanism in which gene expression activity is regulated by ligand.…

A: In prokaryotes, the synthesis of the gene's transcript and its encoded protein product is termed…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: 1. Which of the following signaling events is NOT engaged downstream of phospholipase C (PLC)-gamma…

A: PLC gamma signaling is one of the prominent signaling parhway present in Eukaryotic plasma membrane.

Q: 1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA…

A: Transcription is the process of copying information from a strand of DNA to a newly synthesized…

Q: 7. A molecule of mRNA from bacteria is shown below: 5'- GUUUCCGAGGAGGCGUAUACAUGUCAGUGGGGGC... -3'…

A: Protein synthesis or translation is the final step of gene expression. This process is divided into…

Q: 21. Which of the following is NOT a function/ property of the Signal Recognition Particle  a.…

A: The Signal Recognition Particle (SRP) is a ribonucleoprotein complex and plays important roles in…

Q: of gene. 12. Steroid hormone receptor complex binds to the A. transcription start site B. promoter…

A: Steroid hormones are lipid-soluble molecules that can easily diffuse through the cell membrane to…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: 3. Suggest a role for ActA in addition to Arp2/3 complex mediated actin polymerization. Extend the…

A: ActA promotes directional movement and cellular motility for the bacteria Listeria monocytogenes in…

Q: The SecB protein helps export proteins by:

A: In molecular biology, molecular chaperones are proteins that help big proteins or macromolecular…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: The peptide hormone glucagon tends to elevated in between meals. Among the effects that glucagon has…

A: Eukaryotic elongation Factor 2 (eEF2) mediates translocation of peptidyl-tRNA from A-site to P site…

Q: 3. The peptide hormone glucagon tends to elevated in between meals. Among the effects that glucagon…

A: The interplay of hormonal signals closely regulates the metabolism of biomolecules such as…

Q: (a) Match the following list of RNAS (left side) with their function(s) (right side). w. MRNA X.…

A: The study of molecular biology has led to the discovery of various smaller molecules of RNA which…

Q: cancer-associated kinase.

A: Proto-oncogene tyrosine-protein kinase (Src) is a kind of non-receptor tyrosine kinase protein which…

Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: Select the incorrect statement: OA Transcription produces an MRNA of a gene that leaves the nucleus.…

A: a. We know that genes or DNA are kept in the nucleus. Ribosomes are present outside the nucleus,…

Q: The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: 1. "Interferons (IFNs)‐α and ‐β are expressed in response to a virus infection and are released from…

A: Interferons inactivates protein synthesis in cells to block the viral replication.

Q: Which of the following drugs would you expect would prevent transformation of cells by the Rous…

A: Option D- Reverse Transcriptase Inhibitor-  is the answer

Cell Signaling

It allows cells to perform various cellular activities, coordinate, and interact with other cells. All cells of an organism receive signals from their environments and respond accordingly. Even the unicellular eukaryotes receive signals secreted by other cells and respond. In the case of yeast, mating takes place by signaling between the yeast cells. Communication by cell signaling in a multicellular organism has become a vast and important part of various fields of biology.