ttack complex by the association of C9 protein subunits.

Q: Please explain pros and cons to ketosis

A: Introduction Ketosis can be defined as the process that occurs when our body does not have enough…

Q: What is Scc1 subunit

A: Scc1 along with Scc3, Smc3 and Smc1 form cohesin

Q: How to purify expressed protein

A: Purification is the process where the specific protein is separated or each protein from a mix of…

Q: Name conditions caused by abnormalities of vertical linkages and horizontal (lateral) linkages in…

A: Deformation of the membrane: During RBC deformation, specttrin dimer linkages that emerge along the…

Q: Describe the pathway, and any key events, a nascent soluble polypeptide would follow from the point…

A: Proteins are the major compounds required for the body. These proteins are produced in the the cell…

Q: Explain various vesicle-mediated mechanisms.

A: Vesicles in the cytoplasm move macromolecules across the plasma membrane through vesicle transport…

Q: Define channel protein

A: Cellular transport is the term used to define how the substances move across the membrane of the…

Q: b. In superhelical proteins, such as collagen, several polypeptide helices are intertwined. What is…

A: Introduction  Protein is the key biomolecule in the biological system, any important physiological…

Q: Briefly describe the process of protein making.include the functions of mRNA ,tRNA, and rRNA

A: The nucleus of a eukaryotic cell, such as plants and animals, contains DNA. The nucleus is…

Q: To explain: How the low pH of lysosomes protect the rest of the cell from lysosomal enzymes in case…

A: Many metabolic pathways exist in the human body to maintain homeostasis. Many chemical reactions…

Q: Name and describe the main fuctional macromolecule found in red blood cells

A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…

Q: To distinguish: The integral and peripheral proteins.

A: Prokaryotic creatures are bacteria. They are all unicellular and tiny. The macromolecule class…

Q: Explain the steps involved in transporting a protein through a nuclear pore complex.

A: The nuclear envelope comprises of an internal and an external nuclear membrane. The external…

Q: Define lysozyme

A: Biological molecules that are present in living organisms and are involved in various biological…

Q: If a protein is acted on by a protein kinase, in what way does that change the protein’s structure?…

A: Protein kinases play an important function in cellular activation. A key component of activation is…

Q: Name four intracellular mediators that G proteins impact.

A: G-proteins (Guanine or GTP binding proteins) are the surface proteins that play a crucial role in…

Q: Synaptic transmission requires a vast number of molecular interactions taking place on both ends of…

A: Pre-synaptic events:- These are the events which occurs in neurons which are sending…

Q: Diferentiate between embryonic and adult stem cells.

A: Cell is the basic structural and functional unit of all living organisms. Cells are classified into…

Q: Define CDKs phosphorylate

A: According to the question, we have to provide the definition of CDKs phosphorylate. So, let us have…

Q: disease that results from either protein misfolding or protein misregulation, name of the disorder,…

A: Protein misfolding can occur due to many reasons which include -  genetic mutations, translational…

Q: d. Which types of amino acids could you expect to find on the exterior of transmembrane proteins…

A: The environment in the interior of the lipid bilayer of the membrane is hydrophobic in contrast to…

Q: Early endosomes function as the sorting site of endocytosed material. Diagram and briefly describe…

A: This is an example of a simplified diagram showing the fates of endocytosed molecules. Key…

Q: severe ketosis situations produce acidosis, explain

A: In case of physiologic ketosis, ketones in the blood are higher above baseline levels, however, the…

Q: What is CEN region ?

A: DNA contains inheritable segments that are called genes that contain instructions for protein…

Q: Describe the mechanisms for degrading membrane proteins and cytosolic materials.

A: The degradation of membrane proteins and cytosolic materials is a crucial process for maintaining…

Q: Differentiate between channel protein and carrier protein?

A: The cell's internal composition is regulated by the plasma membrane which provides the permeability…

Q: Is the removal of damaged proteins more important than the proper funciton of new proteins? Yes or…

A: Q.Ans:- Explanation:- Damaged Protein:- Damaged proteins can be formed in multiple ways such as…

Q: Identify the site of ribosomal subunit assembly?

A: Ribosomes occur in all organisms both in prokaryotes and eukaryotes with the exception of mammalian…

Q: Can the extent of the reticulum change in different physiological settings? How?

A: The reticulum is a chamber in the alimentary canal of ruminant animals. The ruminant animals include…

Q: Define α6β4 integrin

A: Proteins are the complex macromolecules of living beings. Most of the hormones and enzymes are made…

Q: “Cells under mild or moderate stress can revert to normal condition” explain the mechanism behind…

A: There are different cellular responses to help restore homeostasis for different types of stress. A…

Q: which amino acid are found in the nonpolar interior of a water soluble protein

A: Proteins are polypeptide molecules comprised of amino acids. Amino acids are organic molecules that…

Q: Checkpoint: Diffusion (1 point each) For each of the following diagrams, indicate the net direction…

A: Osmosis is the movement of molecules from high concentration to low concentration through a…

Q: Explain 1) eryptosis

A: Introduction: The process of hematopoiesis is defined as the production, development, and maturation…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: To distinguish: The integral and peripheral proteins.

A: Proteins, lipids, carbohydrates, and nucleic acids are the four main types of macromolecules found…

Q: Describe two effects that the extracellular matrix can have on the cells that synthesize it

A: The extracellular matrix (ECM) is a three-dimensional network of extracellular macromolecules and…