Q: Convert to cDNA and add linkers
A: This is the High-throughput sequencing that has become the revolutionary technique for the…
Q: What is the target of NK cells? What is the target of phagocytes? What is the target of Cytotoxic T…
A: Introduction :- By preventing the progression of cancers and microbial infections and the resulting…
Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…
A: Please follow step 2 for detailed explanation.
Q: 4. Normal yeast cells can survive on a diet of sugars, a few simple salts and one vitamin. They can…
A: Alleles are the two forms of a gene. Allele control the same trait though differently. For example,…
Q: The Venus flytrap is a carnivorous plant that eats insects. Suppose the county where these are…
A: Loss of habitat is one of the key reasons behind the population declination of many species. This…
Q: What is apoptosis? Explain cell signaling pathways that triggers it.
A: Introduction : A multicellular organism's life cycle includes a crucial process called cell death.…
Q: 25) In most social insects, females (workers and queens) develop from fertilized eggs and are…
A: The conflict of interest between the queen and her worker daughters over the generation of…
Q: Pituitary secretion of adrenocorticotropic hormone (ACTH) is inhibited by elevated levels of: Group…
A: Adrenocorticotropic hormone is also called as ACTH is the harmone released by the pituitary gland.…
Q: pZERO®-1 is a 2808 bp cloning vector from Invitrogen. This vector allows effective selection of…
A: The PET sequences are simentensously traced to the genome assembly to define the boundaries of…
Q: Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading…
A: DNA structure formation
Q: Use the following information to answer the next question. The Canada lynx has a diploid number of…
A: Chromosome is an elongated thread like structure which is present inside the nucleus of the cell. It…
Q: A B Figure 1 The postgraduate student, Vanessa, cloned her gene of interest into two different…
A: A vector is a living organism that can transmits an infectious agent from an infected animal to…
Q: DNAT A C C A C C C C C G T A T G G C T G G G…
A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…
Q: Control of blood flow is primarily mediated by
A: Arterioles, small blood vessels that carry blood away from your heart. They control blood flow…
Q: On the diagram below, i) draw where the uncoupling protein must be located and ii) indicate the…
A: Electron transport chain: A series of protein complexes that are generally found in the outer wall…
Q: Many invasion process models (including the framework in Blackburn et al. 2011) have emphasized that…
A: Invasion : Biological invasion is a process by which an organism introduced to and establishes a…
Q: A polyhistidine-tag or better known by its trademarked name His-tag is an amino acid motif present…
A: In vectors used to produce recombinant proteins, the DNA sequence defining a string of six to nine…
Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.
A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…
Q: Species A has 2 amino acids. minimum codon length: Species B has 7 amino acids. minimum codon…
A: Introduction :- The biggest group of organisms in which any two individuals of the right sexes or…
Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…
A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host speci One of…
A: Shuttle vectors are mostly plasmid vectors that are compatible with two host cells thereby allowing…
Q: The taxon Crocodilia includes crocodiles, Aves includes birds, and Squamata includes snakes and…
A: Monophyletic is a group of organisms which are classified in same taxon and will share the most…
Q: what is natural sciences? what is the value of studying natural sciences and how useful it is to us…
A: Biology is one of the sub disciplines of natural science. Natural science comprises of both life…
Q: During the colony selection at the end of the cloning step, there is a possibility of encountering…
A: During colony screening, false colonies in the plates hinder the selection process, which is…
Q: Explain the roles of cell signaling in DNA transcription and protein synthesis.
A: Introduction Cell signalling is the mechanism through which cells react to information. Cell…
Q: Oldfield mice that live on beaches of the gulf and Atlantic coast of Florida tend to white, wherease…
A: The oldfield mouse or the beach mouse is a nocturnal species of rodent in the family Cricetidae.…
Q: The rapidly growing Japanese knotweed plant has a wide range of growth in North America. This plant…
A: Japanese knotweed Scientifically known as Reynoutria japonica, also known as Fallopia japonica and…
Q: Explain how this is related to increased breathing rate and depth (taking more and deeper breaths)…
A: We can breathe due to our respiratory system and lungs. They release carbon dioxide and inspire…
Q: ATP hydrolysis is exergonic or endergonic
A: Please follow step 2 for detailed explanation.
Q: Explain in detail how are errors occurring during DNA replication corrected
A: In cell biology, DNA replication is a synthesis of making new double strands of DNA. The process is…
Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…
A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…
Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…
A: Removing RNA is one of the crucial processes in plasmid purification, especially after the manual…
Q: Which of the following components found in the bone matrix make bone hard? calcium…
A: The skeletal system gives stability to the body. It is responsible for locomotion of the organisms.
Q: Besides using A. tumefaciencs in the generation of transgenic plants, elaborate on the THREE (3)…
A: Agrobacterium tumefaciens, a gram negative bacteria that is used to perform horizontal gene transfer…
Q: Which of the following substances is unlikely to diffuse across the lipid bilayer of a typical cell…
A: The cell membrane is also known as the plasma membrane. It is made up of two phospholipid layers.…
Q: Kary Mullis invented the Polymerase Chain Reaction (PCR) technique in 1983 which won him the 1993…
A: Polymerase Chain Reaction: A very small DNA sample can be amplified (or part of it amplified) to a…
Q: 1. Consider a cell with surface area 2.5 x 102 mm², initial water potential of -0.3MPa and membrane…
A: When the temperature and the pressure are held constant then the potential energy of the water to…
Q: 32. What are the two components of tRNA which are important for building a protein? what are…
A: The tRNA is responsible for transferring amino acids to the ribosome at the site of translation.…
Q: The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33%…
A: Introduction Genetic material is the portion of a cell that contains the genetic information that…
Q: Living modified organism (LMO) is defined as any living organism that possesses a novel combination…
A: Living modified organism means an organism which genetic materials has been altered artificially…
Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…
A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…
Q: In Semi conservative replication: A. After one round of replication of a single molecule of DNA, one…
A: Answer b) After one round of replication of a single molecule of DNA, two resulting DNA molecules…
Q: Genetically modified foods are products produced from organisms that have had genetic modifications…
A: Biological entities (plants, animals, or microorganisms) in which their genetic material (DNA)…
Q: Name the molecules that cycle thriught living systems
A: Living organisms continuously interact among themselves and also with their environment in order to…
Q: Create a graph as a better way to display the data in the table 2) Determine which mutations (5q,…
A: Tumorigenesis or oncogenesis refers to the initial formation of cancer, where normal cells is prone…
Q: You like a wide variety of types of lettuce, so you plant many different varieties in your garden.…
A: The diversity refers to the different kind of variety of organisms present in an area. A wide…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…
A: Note: As per the guidelines, the first question has been solved here. Please post the other…
Q: 47. Expansion of the extracellular fluid volume leads to an increase in the plasma concentration of…
A: Whenever the extracellular volume is decreased, Anti Diuretic Hormone, aldosterone, and angiotensin…
Q: 2. Why did the reindeer grow at this rate?
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
The schematic on the right is for which molecular biology method?
What information does this method reveal?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Why does the antibody titer determination use twofold dilutions ofthe antiserum rather than 10-fold dilutions?The loopy polypeptide segments at the very top of the structure shown are the segments that actually contact the antigen. Would you expect these binding segments to be rigid or flexible?Following SDS-PAGE, what is an advantage of protein detection by immunoblotting (western blotting) over a non-specific gel-staining procedure? Under what circumstances would it be desirable to nonspecifically stain the gel, rather than immunoblotting?
- U UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…Sticky end ligation is generally preferred over blunt end ligation. Discuss one (1) scenario where blunt end ligation may be better to use instead of sticky end ligation.fill in DNA antisensestrand for this
- The scale bar in panels (a) and (d) in this image is 50 um (micrometei. Question: Which of the answers below is equivalent to 50 um. Figure description: An immunofluorescence image of uninfected cells (top panel a-c) and virus infected cells (bottom panel d-f). a,d) show Hoechst staining (blue) of the nuclei and a merged image of the respective panels: E staining for the virus (red); and c,f) show staining for calreticulin (green). The scale bar (white line) represents 50 um. Hoechst/Merge Virus Calreticulin a C d e O50m 50 x 10 m 50 x 10m 50 x 10 m + Virus Uninfected cellsWhat is T DNA tag?Which letter represents the target site of furosemide (Lasix)? E- -B
- *hi i am studying bioconjugation engineering MBS crosslinker contains aromatic ring in the spacer. discuss if this ring structure helps stabilize maleimides against hydrolysis. Which spacer (aromatic / aliphatic) is better for immunotoxin conjugation. explain why.Second letter A G UCU UCC UAU. Tyr UAC. UUU1 Phe UUC. UUA UUG. UGC Ser }Leu UAA Stop UGA Stop UAG Stop |UGG Trp UCA UCG CAU His CUU CỤC CCU ССС ССА CGU CGC Arg Leu CÁCS Pro CỦA CUG CGA CAAGIN CGG, Gln CAG, CCG J AAU Asn ACU АСC АСА AUU AGU Ser AUC }le A AUA AAC. Thr А AGC AGA AUG Met | ACG ] AAG Lys AG. GUU GUC GCU GAU1 AAsp GACS Ala GAA GGU GGC GCC Val Gly GGA G GUA GCA GUG GCGJ GAG Glu GGG Which peptide is the least likely to be made on the ribosome and why? а. Third letter DUAG 5UAG DUAG DUAG First letterBefore development of a vaccine against this microbe, thedisease it caused accounted for two-thirds of bacterial meningi-tis cases during the first year of life but is still the number oneleading cause of mental retardation in patients who survive seri-ous disease due to permanent central nervous system disorders.What is the microorganism?(a) Haemophilus influenzae type B(b) Haemophilus influenzae type A(c) Neisseria meningitidis(d) Streptococcus pneumoniae(e) Listeria monocytogenes