The impact of communicable diseases (infectious diseases) on human health is obvious. The sudden outbreak of “severe acute respiratory syndrome coronavirus 2” [SARS-CoV-2]” (COVID-19) has made people realize the threat of communicable diseases and their threat to mankind as a complex humanitarian emergency. A highly reactive, multifunctional and efficient emergency management system should be established, and the significance of information communication should be fully understood for the future (Jin et al., 2020). What risk mitigation strategies are being deployed locally and internationally to mitigate the spread of the disease?

Q: If two species are competing for a resource, and one species is a much better competitor than the…

A: When two individuals of different species compete for food or a nesting site for an extended period…

Q: If two species are competing for a resource, and one species is a much better competitor than the…

A: When two species compete for identical resource, it results in competitive exclusion. The principle…

Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice.…

A: Climate changes have shown various consequences not only to the living beings but also to the…

Q: Which of the following is part of the extracellular matrix? A) All of the other answers are correct…

A: The fundamental building block of all living things is the cell. The trillions of cells that make up…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: Describe agglutination reaction test used to determine A, B , AB or O blood types. Must explain each…

A: A blood group is classified on the basis of antigens present on the surface of the RBCs. These are…

Q: Match the correct terms with its definition A. Transcription B. Translation C. Amino acid D.…

A: The genetic material of the cell is made up of DNA and it consists of the information for the…

Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C GTA GA ATT is Using this strand of DNA as a template,…

A: The basis of inheritance is the information passed down from parent to offspring. The replication of…

Q: Best Amyloidosis special stain in sunny areas? a. Congo Red O b. Pagoda Red O c. Crystal Violet d.…

A: Staining is a technique by which microorganisms and cells are stained by dye so they can visible in…

Q: Please Drag and Drop the APPROPRIATE label to the HPT axis. TRH TSH Thyroid Hormone (T3, T4) HPT…

A: Endocrine glands are ductless glands that secrete hormones directly into the blood.  Hormones are…

Q: Use the following information to answer the next question. Some Events that Occur During Meiosis 1…

A: There are two kinds of cell division: mitosis and meiosis, mitosis is the most common way of making…

Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…

A: The emergence of SARS-CoV-2, which generates the COVID-19 sickness, has caused a significant global…

Q: Determining age at death for sub-adults is achieved by looking at the degree of epiphyseal fusion in…

A: Fusion of different bones occurs at age (years): Humerus distal end : 13-16 Femur proximal end :…

Q: D Question 12 Anaphase involves the: Re-forming the nuclear envelope de-compaction of chromosomes,…

A: Answer and explanation - Anaphase -segregation of sister chromatid.  Other charaters- chromatid move…

Q: Environments with low frequency and intensity of disturbance tend to have ________ species diversity…

A: Species diversity It is described as the variety of species that exist in an environment and their…

Q: k at the figure below and answer the following organelles shown are called [Select] locations within…

A: the organelle shown is called - chloroplast   Carbon fixation takes place in stroma (N)

Q: 2. Compare and contrast these energy transformations in Photosynthesis. Light reactions…

A: Photosynthesis: The energy and electron sources for photosynthesis's light processes are sunlight…

Q: Use the following information to answer the next question. A bacterium has been found that…

A: According to Bartleby guidelines a single question or in the case of question having subparts,…

Q: 5. › Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…

A: Enzymes are biocatalysts which increase the rate of chemical reaction by decreasing the activation…

Q: In a homeostatically regulated system, diagram or identify the regulated homeostatic variable,…

A: External substances that disrupt the generation, secretion, distribution, metabolic activity,…

Q: Are cells grown in the laboratory will function similarly when transplanted?

A: Transplanting laboratory-grown cells into the body causes them to behave similarly. For instance,…

Q: Please I need both Question 21 ldentify the tissue that makes the sentence false. Ketones can be…

A: Ketone bodies are produced  by liver which is used as energy source when glucose is not available…

Q: What is a common feature of the voltage sensitive Ca++, Na+ and K+ ion channels? A single…

A: The structure of Na+, K+, and Ca2+ channels is made up of four transmembrane domains arranged around…

Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…

A: Photodynamic therapy (PDT) is treatment that uses drugs called photosensitizers and combine light…

Q: 4. Compare and contrast ESCs and iPSCS by considering the following: B) List two ethical…

A: Stem cells: The human body is composed of multiple cell types that perform various functions. One…

Q: The principles of biomimicry and bioinspiration have been used to design and to engineer…

A: To cope with the complexity of the body and to evade the multiple layers of defense that tissues and…

Q: Drought resistance (dB/Bdt, yr-¹) 0.0 -0.5 -1.0- -1.5 XX HAÏ 13 TNH TT 1910 HARY T Į 1 1/2 -1/4 -1/8…

A: He discovered plots with a greater variety of species but less variance in the total biomass from…

Q: The human body has structures that could be considered the product of “unintelligent design” (i.e.…

A: Organisms are never perfectly designed or adapted. In reality, "perfection" cannot be found in…

Q: how the bacterial cell acts like a fuel cell. Is it sustainable? Explain

A: Particularly in the transportation industry,  attention has switched to renewable  energy and fuel…

Q: List the non-conventional energy sources, explain why Biomass energy is considered to be Renewable…

A: Nonconventional energy sources are also known as renewable energy sources. The energy source which…

Q: a. Explain the purposes of tissue fixation and tissue staining. b. Identify the factors that affect…

A: In this answering session the questions a and b will be addressed, as rest of the questions are…

Q: A blood sample is drawn in NaCitrate. The platelet count on an automated instrument is 305,000/UL.…

A: A platelet count from blood drawn into a sodium citrate tube is multiplied by 1.1 to account for the…

Q: The Amoeba, the paramecium, and the euglena ( These are unicellular Protozoans) produce electrical…

A: Protozoans are  unicellular eukaryotes belonging to the kingdom protista. The structure of…

Q: Describe the difference between the terms INFECTION and DISEASE. Starting with exposure to…

A: Pathogens are essentially any germ or  organism that lives in the bloodstream of  an infected person…

Q: What are the different anatomical joints used in a block start for a sprint? What is happening at…

A: Sprint athletes brace their feet against starting blocks at the beginning of a race to prevent them…

Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…

A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…

Q: Choose the letter that best matches the statement each. Answers may be used more than once or not at…

A: The correct answer to each statement is: Water permeability of this region of the nephron is highly…

Q: Is Enzyme a monomer or polymer?

A: Question : Is Enzyme a monomer or polymer ?    Answer :  Enzyme is a polymer of amino acids.…

Q: The team would now like to establish the smallest possible deletion that would inactivate the…

A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…

Q: Which one of the following statements about gap junctions or electrical synapses is incorrect? A.…

A: Electrical coupling is the transfer of coordinated action potentials from one cell to the next via…

Q: if you replaced the hox genes that are normally expressed in a dolphin fin with the hox genes that…

A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…

Q: The Hardy-Weinberg Principle states that gene frequencies in a population are overall conserved.…

A: The frequencies for a system with three alleles—p, q, and r—can be written as follows:…

Q: Which of the following terms describes bacteriophage DNA that has become integrated into the host…

A: Microorganisms are the tiny entities that cannot be seen as such through naked eyes. They require…

Q: Which of the following is true about global vision loss? a.Over 80% of vision loss can be prevented…

A: At least 2.2 billion people worldwide suffer from a near- or distance vision impairment.  Nearly…

Q: In a specific type of tumor, cytotoxic T cells can recognize but not kill the tumor cell.…

A:

Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…

A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…

Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.

A: Every month, either ovary releases an egg.   1.The uterus's walls swell to become thick and pliable,…

Q: Site of transcription Choose a match

A: All of the given matches are correct but  Transcription takes place in the nucleus.  An RNA…

Q: Choose ALL the events listed below that occur in the cytoplasm of eukaryotes. Select one or more: a.…

A: In eukaryotic cell, translation process occurs in cytoplasm. Translation is the process, that…

Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…

A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.