The following picture drawing represents co-translation in E. coli. Answer the questions: A. Which terminus (N or C) of the growing polypeptide chain is nearer to the letter D? B. Is the letter E nearer the 5' or the 3' end of the molecule?

Q: Give an example of tree whose removal of leaves forms a noncaterpillar tree.

A: Phylum Arthropoda has several classes and “Insecta” is the largest class among all. Insects belong…

Q: Name the chromene rich plants located in India (minimum 10) and their common name.

A: Chromene or Coumarin is utilized in the pharmaceutical business to take anticoagulants. Coumarins…

Q: Explain the basis for tRNA synthetase genes in B. subtilis regulated by T-box RNA leaders.

A: RNA polymerase binds to the lac operon's promoter, which serves this purpose. The transcription…

Q: Pre-work 2- Key Takeaways: The electron transport chain allows for the efficient transfer of energy…

A: Adenosine triphosphate (ATP) is considered to be the energy currency of all cells produced by…

Q: The following DNA sequence is found on a chromosome in rice plants:               5’…

A: Given DNA sequence:  5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…

A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…

Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…

A: Hello, thank you for the question. As you have posted a question with multiple subparts and all of…

Q: A man develops a scrotal skin abscess following vasectomy. Which of the following sets of lymph…

A: Lymph nodes are small, round or bean-shaped structures that are found throughout the body. They are…

Q: In 1988, neurologists in Australia reported the existence of identical twins who had developed…

A: Myoclonic epilepsy is a type of epilepsy that is characterized by myoclonic seizures. Myoclonic…

Q: 3.A human pedigree for inheritance of a disease determined by a mutation in a mitochondrial gene is…

A: Mitochondria in a cell have their own chromosome. Though the size is small and it codes for proteins…

Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…

A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…

Q: IV 1 = female - male 2 3 11 2 4 3 ? 4 C 2 5 5 3 4 6 6 The disease trait in this pedigree is…

A: Autosomal recessive is a pattern of inheritance in which two mutated genes are inherited from each…

Q: Membrane proteins have six possible functions (transport, cell-cell adhesion, sensing signals,…

A: Introduction-Synaptic Transmission- The synapse is the "space" between neurons or neurons and other…

Q: Diabetes type .....is characterized by.....effectively be managed by diet and exercise. 1 (one); an…

A: Diabetes is a chronic illness brought on by either insufficient insulin production by pancrease or…

Q: Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb,…

A: Human sau3AI is a tool used to help predict and diagnose disease. It is a blood test that looks for…

Q: All signaling molecules bind to receptors on the cell surface. Select an answer and submit. For…

A: Ligand molecules are signalling molecules that basically interact with another molecules and…

Q: Introduce the topic of Bean Beetles where the Beetles had to lay eggs on beans. Explain why the…

A: Bean beetle are agricultural pests that occur throughout the tropics and subtropics. The larvae feed…

Q: Do fast

A: Transposons are mainly those genetic elements that have the tendency to move from one place in the…

Q: Which statement is true concerning hominins and the archaeological record? a. There is a 10 million…

A: Human evolution is the evolutionary process, leading upon  the appearance of modern human being.…

Q: The results of blood agar from the umbilical cord(a) and blood culture(b) both show beta haemolysis…

A: Microorganisms require nutrients for life, development, and reproduction, which are provided by…

Q: Determine the process that can be performed to distinguish the genes involved in general stress…

A: Finding the genes that are activated or inactive in response to osmolarity variations requires…

Q: molecular motors

A: Molecular motor proteins: These are a class of molecular motors which move along the cytoplasm of…

Q: For each statement below indicate whether it is true or false: A. Strand discrimination during the…

A: A In eukaryotes, nicks (single-stranded breaks) that are unique to recently manufactured DNA are…

Q: What is energy cycle

A: The energy is the main thing that made the earth suitable for life. Every living organisms need…

Q: Jon performed a pour plate technique to determine the concentration of viable cells in her mother…

A: INTRODUCTION Pour plate technique This technique helps in enumerating bacterial cells in a mixed…

Q: The term archaic Homo refers to a. Homo erectus / H. ergaster b. archaic Homo sapiens c. Homo…

A: INTRODUCTION Archaic human : human species seen between Homo erectus and Homo sapiens.

Q: Crystal Uric acid Amorphous urates Calcium oxalates Amorphous urates Calcium phosphate Triple…

A: Blood volume and concentration, as well as blood pressure, pH, and glucose levels are all controlled…

Q: B. ABO Frequencies Agora The ABO Blood Group System has one genetic locus that exhibits three (3)…

A: ABO blood group system involves the 3 alleles -A, B, and O and hence constitute the inheritance of…

Q: 4. Which part of the alimentary tract does the pancreas attached with? What are the functions of the…

A: INTRODUCTION Pancreas:- This is the organ that produce enzymes for digestion. Trypsin and…

Q: Through which tissue do sugars get transported to reach the leaves during growth and reproduction?

A: Introduction Plants are the immotile organisms, which live on soil and water. They prepare there…

Q: 10.0 8.0 6.0 5.0 4.0 3.0 2.0 1.5 1.0 0.5 MC 179 196 198 210 222 234 253 254 M נות

A: To pinpoint a specific gene's location on a chromosome, geneticists employ maps. In one kind of map,…

Q: Drag the images/descriptions given to the correct category to assess your understanding of the…

A: Introduction :  Bacteria can be categorised in a number of ways depending on their morphology,…

Q: Organisms ATP NADH NADPH FADH2 Ethanol 1 20 100 0 0 50 2 350 400 0 100 1 3 500 410 200 100 1 Three…

A: Energy is spontaneously produced during cellular respiration, which involves several metabolic…

Q: A woman in her 60's has a brain biopsy following the identification of a brain lesion. The lesion is…

A: Brain biopsy Is a surgical technique that involves the removal of a sample of aberrant tissue for…

Q: Homo habilus can be characterized as____. a. more robust than P. boisei b. somewhat similar to Au.…

A: The Latin word homo means "man" or "human." To emphasize how closely related this species is to our…

Q: Do both cardiac and smooth muscle have gap junctions?

A: Introduction Gap junctions are channels that bodily join adjoining cells, mediating the fast change…

Q: The main components that make up DNA are Otwo dipeptides a dipeptide and an amino acid O a single…

A: Introduction DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in the…

Q: 46. List 3 parts of the brain that are specifically involved in memory a. Amygdala, Hypothalamus,…

A: The neuroanatomy of memory includes a broad range of brain structural features. It is now obvious…

Q: Briefly explain why having a forelimb lever with high MA is potentially advantageous.

A: Introduction :  One of the paired articulated appendages (limbs) attached to the cranial (anterior)…

Q: Please answer fast

A: Our bodies require a trace quantity of salt for a range of processes, including neuron and muscle…

Q: 1. Do all bacteria contain storage granules at all stages in their life cycle? Yes or No?

A: Introduction :  Cytoplasmic granules or inclusion bodies are concentrated deposits of specific…

Q: Do you think these different regional populations are different species that could only occasionally…

A: Introduction A population comprises all the organisms of a particular species in a particular…

Q: Phospholipids are those lipids that make up the cell membranes of most living things. They are…

A: Phospholipids:  Phospholipids are a subclass of lipids that have two hydrophobic "tails" made of…

Q: In fruit flies, long wings (M) is dominant to miniature wings (m) and red eyes (B) is dominant to…

A: Introduction:- Genes are known as the units of inheritance. They are present on the chromosomes, in…

Q: Describe one chemotherapeutic approach that can be used to treat prostate cancer? (Your answer…

A: Introduction:- Cancer is defined as the uncontrolled and unregulated proliferation of normal cells.…

Q: 27) A tRNA is activated when it A) attaches to mRNA. B) attaches to its specific amino acid. C)…

A: A form of RNA molecule called transfer ribonucleic acid (tRNA) aids in the translation of a…

Q: 3. Explain how genetic drift can lead to a reduction in the genetic variation within a population

A: The processes of evolution do not operate independently in natural communities. The ramifications of…

Q: Mutants were isolated in which the constitutive phenotype of a missense lacl mutation was…

A: In an experiment, the mutants were isolated in which the constitutive phenotype of a missense lacI…

Q: List five characters you have that are analogous to characters with the same function but of…

A: Analogous organs are those which superficially appear similar due to their adaptation for similar…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.