The enzymes of glycolysis in the eukaryotic cell are in the _____. a. intermembrane space b. mitochondrion c. cytosol d. plasma membrane
Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…
A: Qualitative tests detect the presence of specific molecules in a sample solution. There are…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Which post-transcriptional modification is NOT shared by all eukaryotic RNAs? a. Modifying bases…
A: Posttranscriptional modification is the process by which the RNA primary transcript is chemically…
Q: The enzyme creatine kinase catalyzes the ATP-dependent phosphorylation of creatine. Propose a…
A: Introduction: Creatinine is the waste product formed in muscle from a high-energy storage compound…
Q: 3. How does dimerization of a receptor tyrosine kinase promotes autophosphorylation of the…
A: The tyrosine kinase-associated receptors contain an N-terminal extracellular ligand-binding domain,…
Q: What is the meaning of DFR?
A: DFR is Dihydroflavonol 4-Reductase (DFR), it is expressed by DFR gene.
Q: If OAT takes ornithine and alpha-ketoglutarate as (a) substrates, draw the structures of the…
A: Aminotransferases are group of enzymes that catalyzes the transamination reaction between amino acid…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…
A: Biological macromolecules are constituted of proteins , nucleic acids (DNA or RNA), carbohydrates…
Q: Write notes on the following:
A: Alcoholic drinks are the widely used from of drinks and it is used all over the world. Alcoholic…
Q: Choose the best term that fits this description in a general sense: "A cellular component to which a…
A: Plant derived or synthetic drugs bring a measurable change into a cell once it binds to a cellular…
Q: What is the maximum number of possible intra-peptide disulfide bonds for any given peptide form?
A: The side chains of Cysteine residues in proteins undergo oxidation to form disulfide linkages.
Q: Propionic acid with a pk of 4.88 is a weak acid. Which situation is likely to occur in a propionic…
A: Introduction: The ionization constant (pKa) is a value that tells us the tendency of compounds or…
Q: One indication of the relative importance of various ATP-producing pathways is the Vmax of certain…
A: Pheasant pectoral muscles are clearly anaerobic, as expected from a bird highly trained for…
Q: If an amino acid weighs 100 Da, and the protein contains 70 amino acids, what is the weight of the…
A: Amino acids are the building blocks of proteins. Multiple amino acid units are joined together to…
Q: You are trying to annotate a new phage genome; which program or programs should you use to determine…
A: Phamerator is computational tool that is designed to sort out phage genes into phage families of…
Q: for GABA transaminase, ornithine decarboxylase, and alanine
A: PLP-dependent enzymes catalyse a wide range of reactions that result in bond cleavage at the carbons…
Q: Which critical product/s of the light reaction are required for the Calvin cycle? О ATP O NADH O O O…
A: Photosynthesis is divided into light and dark reactions. In photosynthesis carbon dioxide is used to…
Q: What cofactor is formed when this reaction proceeds right during glycolysis? OPO,CH O OH 2-OPO,CH,…
A: Glycolysis is classified as one of the cytoplasmic pathways. The main role of this pathway is to…
Q: 9. Which of the following changes would not affect a peptide GENSHIN? A. Heat B. Inorganic Salts C.…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Does different kinds or types of tea produces different amount of caffeine content? Why? Why does…
A: Caffeine is categorized as a type of a bitter substance. The caffeine occurs in a number of…
Q: What does the last number in the numeric designation of enzymes refer to?
A: Each enzyme is allocated a four digit EC number,an enzyme Commission number does not specify enzymes…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: The RNA is synthesized by RNA polymerase enzymes from a DNA template through DNA transcription.…
Q: What is the principle of dialysis? A. Highly soluble contaminants will be removed as the…
A: The removal of contaminants from a protein sample is important in the purification of proteins.
Q: Fatty acid oxidation for energy yield occurs in the mitochondrial matrix, and for palmitate as one…
A: Ketone bodies are an alternative fuel source that replace glucose as the main fuel under conditions…
Q: Aldolase enzymes have the following rate constants. k₁ = 10³M ¹s¹, k-₁ = 4.4x10 s ¹, k₂ = 10's-¹ -1…
A: Consider the following single substrate (S) enzyme (E) catalyzed reaction mechanism given below E +…
Q: Which of the following was used to extract DNA from the food products for the GMO lab? Ethanol…
A: DNA extraction is a technique to separate DNA from the given cell sample. It involves the steps…
Q: efly
A: There are various methods of studying the Enzyme-substrate complex like magnetic resonance…
Q: Given a mixture of three proteins, A, B and C, with isoelectric points pIA = 4.2, pIB = 7.0 and pIC…
A: The isoelectric point (pI) of a protein is defined as the pH at which the net charge of a protein…
Q: How does salt help in the DNA extraction process?
A: DNA is extracted to compare the DNAs from different sources and to study the sequence differences.…
Q: Currently available INSULIN PRODUCTS/MEDICATIONS in the market: Brand Name Route Onset (min.)…
A:
Q: You need to prepare an acetate buffer of pH 5.43 from a 0.621 M acetic acid solution and a 2.95 M…
A: At equilibrium 0.40875 - x moles of acid x moles of its conjugate base. Initial moles of CH3COOH…
Q: /hen the acetyl-CoA produced during B-oxidation in the liver exceeds the capacity of the citric acid…
A: The oxidation of some amino acids into fatty acids, as well as glycolysis, is the source of acetyl…
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: Which of the following statements about protein digestion are true? Check all that apply. ► View…
A: Proteins are macronutrients, which act as the building blocks of the body. Proteins can also act as…
Q: Snake venom contains many hydrolase enzymes, including several serine proteases. One such protease…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: Design an experiment, using western blot, to test whether a certain amino acid sequence sends a…
A: Western blot is a method to detect the specific protein in the mixture of the proteins. In this…
Q: Which of the following is present in sphingolipids? a). fatty acid b). carbohydrate c). phosphate…
A: Lipid molecules are o amphipathic nature and these molecules are used to make the plasma membrane.…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: Draw, label, and explain the three stsges of lipid oxidation
A: Lipid peroxidation may be defined usually as a technique below which oxidants consisting of…
Q: Which of the following enzymes catalyze the ADP-ribosylation of key cellular enzymes or proteins? a.…
A: ADP-ribosylation is a dynamic post-translational conversion of proteins that regulates a variety of…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Amino acids are monomers of protein they are linked with each other by forming…
Q: What is the total number of ATP molecules that can be produced from the complete oxidation of one…
A:
Q: depletion of NAD+
A: Nicotinamide adenine dinucleotide ( NAD) is a coenzyme central to metabolism. It is found in all…
Q: Compare the difference between tagatose and Lelior pathway & Differentiate the pathway fucose and…
A: You have asked 2 questions, only 1st question can be answered as allowed by guidelines. Please…
Q: In the absence of oxygen, what would happen to a cell that performs aerobic cellular respiration? O…
A: There are two type of cellular respiration.One is aerobic cellular respiration and other is…
Q: Pathologic and Non-pathologic causes of Urine Turbidity.
A: A turbid urine is defined as an unclear and cloudy urine when viewed directly. There can be various…
Q: Draw amylose and cellulose. Explain the differences Can we digest both molecules? Why or Why not?
A: Both Amylose and Cellulose are polysaccharides containing glucose residues.
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
The enzymes of glycolysis in the eukaryotic cell are in the _____.
a. intermembrane space
b. mitochondrion
c. cytosol
d. plasma membrane
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The process of oxidative phosphorylation occurs in the: a. Cytosol b. Mitochondrial matrix c. Intermembrane space d. Inner mitrochondrial membraneIdentify the following properties as belonging to mitochondria, peroxisomes, or ribosomes. a. Detoxify chemicals such as alcohol b. Can be bound to a membrane or suspended in the cytosol c. Metabolize fatty acids d. Make most of the ATP for the cell e. Synthesize proteins f. Produce certain phospholipidsWhat distinguishes mitochondria from other organelles is their unique property. Why is it referred to as the "powerhouse" of the cell?
- Glycolysis, which can occur in all living cells, correctly occurs in the cell structure _____, and the products that result respectively are Select one: a. mitochondria: 2 ATP, pyruvate, NADH b. cytoplasm: 2 ATP, pyruvate, NADH c. cytoplasm: 36 ATP, CO2, H2O d. mitochondria: 36 ATP, CO2, H2OProkaryotic cells that can use cellular respiration to make energy perform some of that process using the cell membrane, since they lack membrane-bound organelles. Eukaryotic cells, on the other hand, start the process of cellular respiration __________ and finish it __________. on the cell membrane; in the Golgi apparatus in the cytoplasm; in the mitochondria in the Golgi apparatus; on the cell membrane in the mitochondria; in the cytoplasmA cell that produces glycoproteins that contain 8-9 mannose residues per sugar chain has a glycosylation enzyme defect in which of the following organelles? A. Endoplasmic reticulum B. Golgi apparatus C. Lysosomes D. Mitochondria E. Plasma membrane
- _______ is the start of most secretary pathways? A. Mitochondria B. Endoplasmic reticulum C. Golgi-apparatus D. Lysosome E. PeroxisomeThe mitochondria are often referred to as "the powerhouse of the cell," which is true, but an incomplete picture of the various whole organism biology that the mitochondrion has contributed to. For this question, choose another aspect of biology in which the mitochondria is known to have contributed to, other than just energy generation, and in a few well-structured sentences describe the biological importance of this teeny, amazing organelle to the biological aspect you have chosen.Which of the following is not a component of the endomembrane system? a. mitochondrion b. Golgi apparatus c. endoplasmic reticulum d. Iysosome
- Cellular respiration is completed in the ______. a. nucleus b. mitochondrion c. plasma membrane d. cytoplasmWhich of the following organelles produces largequantities of ATP when both glucose and oxygen areavailable to the cell?a. mitochondriab. peroxisomesc. lysosomesd. ERThe main components of a mitochondrion are: Outer membrane O Thylakoid membrane O Cytosol O Inner membrane Grana O ATP Synthase for chemiosmosis Vacuole O Endoplasmic reticulum Stroma
