
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question

Transcribed Image Text:. The amylase enzyme can only break down starch and not proteins. Why?
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardWhat products are formed by the enzymatic hydrolysis of starch? How can you tell the enzymatic hydrolysis of starch is complete?arrow_forwardAmylase is derived from __________ of bacteria.a) Proteins b) Insulin c) Amyloproteins d) Hormonesarrow_forward
- Why would enzymes be found as isozymes?arrow_forwardWhat glycolytic intermediate is fructose converted to in the liver, such that it can be utilized in glycolysis? Glyceraldehyde 3-phosphate Glucose 6-phosphate Fructose 6-phosphate Fructose 1-phosphatearrow_forwardDisaccharides like lactose can barely get through dialysis tubing, but CAN NOT move across a cell membrane. What must happen to disaccharides and polysaccharides that we eat in order for our cells to use them as energy molecules? What must be present in the digestive tract for this to happen?arrow_forward
- If you are using cellular respiration to get energy from proteins rather than carbohydrates, which of the following is true? there are completely different reactions for protein breakdown as compared to carbohydrates so a different set of pathways is used the amino acids must be broken down into individual C-H or C-C bonds and then those bonds will join with others to create a sugar that enters into the glycolysis pathway O the amino acids are joined with a covalent bond to a sugar and then the hybrid molecule will enter the cellular respiration pathways the amino group is removed and then the rest of the molecule is converted into molecules such as pyruvate or oxaloacetate that can then enter cellular respiration pathways O the amino acids must first be converted into glucose and then they can go through the cellular respiration pathwaysarrow_forwardMost of the micronutrients are transition elements. What property of the transition elements makes them especially suitable for their roles in the body?arrow_forwardWhich of the following enzymes is responsible for breaking a1-4 glucose bonds and forming a1-6 glucose bonds? glycogen phosphorylase branching enzyme glycogen synthase debranching enzymearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education