GENERAL BIOLOGY II IS THE SUBJECT!! THANK U 12:07 9© § a .| 58%The ability to recombine geneticmaterial from different organisms,resulting in the production of agenetically modified organism, ishighly possible for which of thefollowing reasons?A. the basic chemical structure ofthe genetic material of allorganisms is highly variableB. All organisms are capable ofreproductionC. DNA vectors are readily taken upby all organismsD. the basic chemical structure ofthe genetic material of allorganisms is the sameGenetically engineered bacterium isused for the production of:A. human insulinB. cortisolC. thyroxineD. ephedrine 12:0758% יו 2סIn genetic engineering, vectors areneeded in the process and play acrucial role because these moleculesA. degrade nucleic acidsB. help in replicationC. carry foreign DNA into cellsD. protect host cells from invasionby foreign DNAThe ability to recombine geneticmaterial from different organisms,resulting in the production of agenetically modified organism, ishighly possible for which of thefollowing reasons?A. the basic chemical structure ofthe genetic material of allorganisms is highly variableB. All organisms are capable ofreproductionC. DNA vectors are readily taken upby all organismsD. the basic chemical structure of

Answered: Image /qna-images/answer/05cadd72-27c7-466f-9a58-64401fa3202f.jpg

The ability to recombine genetic material from different organisms, resulting in the production of a genetically modified organism, is highly possible for which of the following reasons? A. the basic chemical structure of the genetic material of all organisms is highly variable B. All organisms are capable of reproduction C. DNA vectors are readily taken up by all organisms D. the basic chemical structure of the genetic material of all organisms is the same Genetically engineered bacterium is used for the production of: A. human insulin B. cortisol C. thyroxine JO D. ephedrine

The ability to recombine genetic material from different organisms, resulting in the production of a genetically modified organism, is highly possible for which of the following reasons? A. the basic chemical structure of the genetic material of all organisms is highly variable B. All organisms are capable of reproduction C. DNA vectors are readily taken up by all organisms D. the basic chemical structure of the genetic material of all organisms is the same Genetically engineered bacterium is used for the production of: A. human insulin B. cortisol C. thyroxine JO D. ephedrine

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 36CTQ: What is the consequence of mutation of a mismatch repair enzyme? How will this affect the function...

See similar textbooks

Similar questions

Mutations in the dnaA gene of E. coli are lethal and canonly be studied following the isolation of conditional,temperature-sensitive mutations. Such mutant strains grownicely and replicate their DNA at the permissive temperatureof 18°C, but they do not grow or replicate their DNA at therestrictive temperature of 37°C. Two observations were usefulin determiningthe function of the DnaA protein product.First, in vitro studies using DNA templates that haveunwound do not require the DnaA protein. Second, if intactcells are grown at 18°C and are then shifted to 37°C, DNAsynthesis continues at this temperature until one roundof replication is completed and then stops. What do theseobservationssuggest about the role of the dnaA gene product?
ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
22.Identify the single most correct answer: (a) Ames assay (test) can be used to identify carcinogens but not mutagens. b) Conjugation in viruses can result in production of an antibiotic resistant virus. c) Certain groups of viruses are responsible for the process of transduction in bacteria. d) Organisms in their natural environment cannot exchange genetic information. e) c and d 24. In a use-dilution test, for microorganism X, we evaluated 3 different disinfectants T1, T2 and T3 with the following disinfectant dilutions: 1/10, 1/100, 1/1,000 and 1/10,000. T1 killed the microorganism up to the dilution of 1/100; T2 killed the microorganisms up to the dilution of 1/10,000 and T3 killed the microorganisms up to the dilution of 1/1,000. Rank the disinfectants in the order of their strength with the strongest being first, for disinfecting contaminations with microorganism Xor alternatively are they all equally effective? Choose the most correct answer. a) T1 (the strongest), T2, T3…
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
2. pBR3322, an artificially made plasmid, is shown below. ECORI Hindill BamHI Pstl Amp ORI ↓↓ Tetr pBR322 (4.36 kb) ↑ Pvull Xmalll Describe 3 features that this plasmid has and indicate each one on the diagram. i) ii) 111]
Practice question #3 chap. 2 p. 145 3. What do you think happened? How do you explain this result? Your supervisor gives you an E.coli stain (strain PIP) with an F plasmid on which is coded resistance for ampicillin. Your E.coli strain (strain ZAZ) is F- for the plasmid, and you would really like your strain to have ampicillin resistance. To favour conjugation, you grow both strains together for 2h (in broth) and plate agar containing ampicillin to grow single colonies overnight. grow overnight Inoculate agar plate containing ampicilline (amp plates) ZAZ colonies are blue, PIP colonies are yellow. Grow ZAZ and PIP together for 2h Figure 1. Schematic representation of the experimental plan. In the morning, you find multiple colonies growing on your ampicillin resistant agar plates. Because you had mixed both strains in the same culture, you needed to be able to distinguish between which colony is a ZAZ or a PIP colony growing on your plate. Fortunately, your ZAZ strain grows blue on the…
Various antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider the following antimicrobial drugs: A. Seconeolitsine, known as DNA topoisomerase I inhibitor in bacteria. (i) Explain briefly how inhibiting DNA topoisomerase I is a good mechanism of action for an antibiotic, include possible molecular machineries being targeted. (ii) What would be an appropriate response if seconeolitsine works well by stating the state of supercoiling in bacteria. (iii) To prove your answer (ii), you test the condition of bacterial DNA by running gel electrophoresis, one has been treated with seconeolitsine (+ sample) and the other one is not (- sample). Explain the position of each + sample and – sample band on the gel in reference to the point of origin (where you load your samples) or how far each DNA sample travel across agarose gel. (iv) Explain why you would expect answer (iii) for each + sample and – sample. B.…
Q.No.4. A) Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGACB) Specify the method for Purification of DNA fragment after digestion.(Genetic engineering).
4. Animation 12.4: This table shows results from a genetic test conducted on DNA samples from two patients. The patients are a newly married couple seeking genetic counseling about their risks of passing on a genetic disease to any children they may have in the future. The samples included the DNA region including and immediately surrounding a single gene. Restriction enzyme cleavage analyses were performed on the samples. Female Patient 1) 3400 bp fragment Male Patient 1) 1600 bp fragment 2) 1800 bp fragment 3) 3400 bp fragment DNA fragments on gel What do the genetic test results indicate about this case? O Both the woman and the man are homozygous for the mutation. O Both the woman and the man are heterozygous. O The woman is homozygous for the mutation and the man is homozygous for the normal gene. O The woman is homozygous for the mutation and the man is heterozygous.
Q 1. Download and read the attached review article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC342244/pdf/nar00470-0155.pdf titled: MspI, an isoschizomer of HpalI which cleaves both unmethylated and methylated Hpall sites and answer the following question: Restriction enzymes have many applications from gene cloning to gene activity and mapping. Use the two above mentioned restriction enzymes to study transcriptional silencing (consider Southern blot method for your example)
a- https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5866609/pdf/pnas.201800195.pdfb- (Article is no longer available) Here are the articles provided within the question - They are not needed but are available if additional information is warranted - The figures being mentioned are already provided. This is Biochemoistry, please answer each part to the best of your ability. There are a max of 3 parts due to guidelines and please answer each part with clear and efficient work with answers. Thank you
21:14 +4G KB/S LTED 41 96 09.00 Vo Microsoft Word - Assignment 02.docx Assignment 02 1. Groups of alleles associated with the lactose operon are as follows (in order of dominance for each allelic series): repressor, IS (superrepressor), I *(inducible), and I "(constitutive); operator, OC (constitutive, cis dominant) and 0+ (inducible, cis- dominant); structural, Z and Y. (a) Which of the following genotypes will produce B-galactosidase and B-galactoside permease if lactose is present: (1) 1*0* Z* Y*, (2) 1 *OCZ+ Y+, (3) OCZ+ Y+, (4) IS O+ Z+ Y+, and (5) 10+ Z+Y+? (b) Which of the above genotypes will produce ß-galactosidase and ß-galactoside permease if lactose is absent? Why? 2. By what mechanism does the presence of tryptophan in the medium in which E. coli cells are growing result in premature termination or attenuation of transcription of the trp operon? 3. Suppose that you used site-specific mutagenesis to modify the trpL sequence such that the two UGG Trp codons at positions…