Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype Sequence A IV-3 B IV-4 B IV-8 BIV 9 CIV-3 DIV-4 Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA 2. Identify and highlight all the nucleotides that differ between at least two sequences in each table. 3. Pretend that you are the researcher who discovered the variations and you are writing to a colleague describing what you found. a. How would you describe the variation(s) you found in Sequence 1? b. How would you describe the variation(s) you found in Sequence 2?

Table 2. DNA Sequence 2 from Lactose-Tolerant and -Intolerant Individual Individual Phenotype Sequence A IV-3 B IV-4 B IV-8 BIV 9 CIV-3 DIV-4 Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACGCTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 1, Chromosome 2: ATAAAGGACACTCTTGACAA Copy 2, Chromosome 2: ATAAAGGACACTCTTGACAA 2. Identify and highlight all the nucleotides that differ between at least two sequences in each table. 3. Pretend that you are the researcher who discovered the variations and you are writing to a colleague describing what you found. a. How would you describe the variation(s) you found in Sequence 1? b. How would you describe the variation(s) you found in Sequence 2?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Linkage analysis. is used to create a physical map is based on the natural recombination process requires radiation hybrid mapping involves breaking and rejoining of DNA artificially
13-14. A set of Hfr strains transfer markers in the following order. Strain Transfer order JIAF G 1 ED BGFA IJH CE D CED B 13. Which of the following gene orders is correct? A: AFGEDBCHIJ B: ECHIJAFGBD C: E D B G FACH JI D: E D B G FACHIJ E: A F G BD ECHJI 14. Which Hfr strains have F factors inserted in the same orientation? A: 1 and 3 oriented the same way, 2 and 4 both oriented the other way B: 1 and 2 oriented the same way, 3 and 4 both oriented the other way C: 1 and 4 oriented the same way, 2 and 3 both oriented the other way D: 1 oriented one way, 2, 3 and 4 all oriented the other way E: all are oriented the same way 2 UYSerlero
Why is 26 incorrect
Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the mechanism by which it forms aclosed ring upon infection of the host cell. 5'GGGCGGCGACCT:double@stranded region-3' 3'- double@stranded region:CCCGCCGCTGGA5'
U UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…
Arial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000
1. Inversion type that produces inv9 and inv12 2.Condition caused by translocation between chromosomes 8 and 2 and what specific type of translocation? 3.Point mutation with no abnormal effect 4.Physical agent that displaces electron from neutral atoms. 5.Formed when nonionizing agent disrupts cytosine-guanine pairing.
/take S. pyogenes may contain deoxyribonuclease. What is the role of this enzyme? Deoxyribonuclease facilitates the production of DNA from bacterial cells. Deoxyribonuclease is an enzyme that replicates DNA and then proteins. O Deoxyribonuclease breaks down proteins and damages the cell. O Deoxyribonuclease breaks down DNA released from damaged cells. Question 4 Which organism can produce pyocyanin? MacBook Air
EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein
Which of the following can be used to carry foreign DNA into host cells? Choose all correct answers. a. RNA b. viruses c. PCR d. plasmids e. lipid clusters f. blasts of pellets g. xenotransplantation h. nanoparticles
A plasmid is a circle of ___ . a. RNA b. DNA c. either RNA or DNA d. histone proteins
The genotype XXY corresponds to Klinefelter syndrome Turner syndrome Triplo-X Jacob syndrome