Suppose that one of Pasteur's swan neck flasks had broken, such that the neck came off. What would be the likely result? Maggots would have appeared on the meat The broth would have remained sterile Bacteria would not have been isolated in pure culture The animalcules would have escaped The liquid would have become contaminated You have a mixture of bacteria, archaea, fungi, protists, and algae. Which of the following would be most definitive in determining which of these cells are archaea? Size in a bright field microscope Structure in a scanning electron microscope Fluorescence in situ hybridization Super resolution microscopy Simple staining

Suppose that one of Pasteur's swan neck flasks had broken, such that the neck came off. What would be the likely result? Maggots would have appeared on the meat The broth would have remained sterile Bacteria would not have been isolated in pure culture The animalcules would have escaped The liquid would have become contaminated You have a mixture of bacteria, archaea, fungi, protists, and algae. Which of the following would be most definitive in determining which of these cells are archaea? Size in a bright field microscope Structure in a scanning electron microscope Fluorescence in situ hybridization Super resolution microscopy Simple staining

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter11: Health Of Aquatic Animals

Section: Chapter Questions

Problem 5KA

See similar textbooks

Similar questions

If you are to invalidate the abiogenesis theory using Louis Pasteur’s experiment, how will you explain the existence of bacteria in a part of his set-up? Refer to the attached photo.
You are a doctor at a field hospital deep in the Amazon jungle. A local villager comes to you sick with nausea, diarrhea and vomiting and you suspect they may have food poisoning. Several different types of bacteria can cause food poisoning including Campylobacter jejuni, Staphylococcus aureus, and Salmonella tyhphirium. How will using a microscope help you to identify which of the three bacteria are responsible for making your patient sick so that you can administer the correct antibiotic?
How does the streak plate technique help in isolating individual colonies of bacteria? Why streak multiple times on one plate? 3. While observing a plate inoculated with bacteria you observe a white-tan fuzzy growth. What can you interpret from this observation? Explain how this outcome could’ve occurred. 4. What are 3 possible errors that could take place as you culture your samples which could lead to contamination? State 3 and explain why. Microbiology class
If your instructor gave you a culture containing one species of a microorganism, how would you be able to tell whether it was an archaean, a bacterium, a fungus, or a protist? Identify and explain characteristics you could use that would allow you to distinguish amongst these types of microorganisms. Assume that you would have available any equipment or technologies needed to identify each organism. TTTT Paragraph v Arial v 3 (12pt) T 只i8公 EST T, - fr Mashups 囲圈田图□mMTML css
A particular bacterium is said to have a streptococcus morphology and arrangement. What does this mean? the cells are rod shaped and occur in clusters the cells are round and occur in chains the cells are round and occur in clusters the cells are spiral and occur singular
You want to recognize a love of bread and beer. To which of the following taxonomic groups should you address a poem applauding the accomplishments of certain microbes responsible for their production?
Choose the false statement: (Regarding Pasteur’s famous experiment) The swan necked flasks were important because they allowed the broth to remain sterile, while still remaining open to the atmosphere. Pasteur’s work with the swan neck flasks was only of importance to the food industry; his work occurred long before anyone, including Pasteur, had any awareness that diseases could be caused by microscopic agents. The swan necked flasks were used to prove that life could only arise from pre-existing cells.
7a. A petri plate is given to you with 80 colonies on it. I tell you that I did five 10x dilutions and then plated 0.1 ml from my last tube to get 80 colonies on a plate. How many living bacteria per ml were in that original sample? Draw out (or describe) all of the dilutions I would have done to get this number. 7b. Again, I have a plate with 80 colonies on it, but I tell you that I did one 100x dilution and two 10x dilutions before I plated that 0.1ml from my last tube. How many living bacteria per ml were in that original sample? Draw out (or describe) all of the dilutions I would have done to get this number. please include drawings. thank you
Bacterium A Bacterium B Bacterium C Bacterium D A Phylogenic Tree is a way to show the relationships between species, the way a family tree shows relationships between people. We use similarties and differences between organisms to determine their relationships by placing them within the tree. Instructions (1) Pick an unknown bacterium from the top of this sheet, and beginning at the top of the tree use the prompt at each junction to decide which branch to move down. (2) Once at the bottom, the bacterium has been identified within the C phylogeny. Yes (3) Repeat with the remaining bacteria to determine how they're related! CILIA? No Yes ADD BACTERIA HERE ADD BACTERIA HERE ADD BACTERIA HERE GREEN? No Outside ADD BACTERIA HERE Bacterium E CHERIE START BACTERIA HERE! SHAPE? Round PROTEIN? No Yes Inside BLUE? Yes Bacterium F ADD BACTERIA HERE www. Rod CILIA? No ADD BACTERIA HERE www Bacterium G E SHAPE Yes Round ADD BACTERIA HERE Bacterium H Rod CHLOROPLASTS? CILIA? FLAGELLA? No No Yes Yes…
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is a procedure you could do, involving making a slide of the organism?
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is one experiment you could do, involving culturing the organism?