Spell out the name of the polypeptide using three letter codes for each amino acid separated with hyphens (for example, Tyr-Lys-Trp).

There are different tRNAs for each amino acid. What is one major way to differentiate among the tRNAs for each amino acid?

If the sequence of DNA on the template strand of a gene is AAA, the mRNA codon produced by transcription will be and will specify the amino acid A. UUU, phenylalanine B. AAA, phenylalanine C. AAA, lysine D. TTT, arginine In the given anticodon CCA - UAU - UCG, what is the resulting amino acid sequence? A. glycine-isoleucine-serine B. histidine - serine - tyrosine C. proline - tyrosine - tyrosine D. proline - isoleucine - serine Which sequence of amino acids shows the corresponding polypeptide for DNA Sequence 3' AAGGCCGCA-5'? A. phenylalanine - arginine - arginine B. phenylalanine - alanine-alanine C. lysine - alanine - alanine D. lysine -arginine - arginine

How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…

Given the messenger RNA sequence, determine the amino acid sequence of a peptide.

Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?