Specifically, why is the primer needed in order for DNA ploymerase to start synthesis? A ) primers provide the free OH group needed by DNA polymerase to make the first covalent bond B) to prevent DNA helicase from breaking too many H bonds C) the DNA is in danger of becoming denatured without a primer D) primers provide the free phosphate group needed by DNA polymerase to make the first covalent bond E) primers will provide enough energy to help the reaction occur

PCR primers are designed to only replicate the N gene sequence of the viral genome. Part of the N sequence we want to amplify is shown below. Typically, you design two primers, one to bind to each strand of the dsDNA. Copies are made from each strand so you get twice as much DNA from the PCR process. Potential primer locations are noted by the nucleotide sequences shown below. The PCR needs to make copies of the nucleotides shown in the middle (“87 nucleotides”). Remember the direction that DNA polymerase synthesizes new DNA strands. Select the two locations for the primers to bind and then fill in the correct sequence below the DNA sequence shown. You should have selected one location on each strand. Indicate the direction that the DNA polymerase (Taq polymerase) will move after binding to the primers in the attached image

The answer is option A  In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are :   ATGTTTGTTTTTCTTGTTTTA  and  GTCAAATTACATTACACATAA   CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)

The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the quantity of DNA is very small, mixed, or contaminated with other organisms. Explain (with words) the how PCR works using a diagram to help illustrate this (show a minimum of three cycles to illustrate your point).

3' 5' Shown is a segment of DNA about to be replicated. a) What is the sequence of the complementary parent strand? > Be sure to label the 3' and 5' to the ends of your strand. Determine the leading strand. b) What is the sequence of the copied leading strand? > Include an RNA primer at the beginning of the strand that is 4 nucleotides in length. (Box/Highlight/Bold this segment) Be sure to label the 3' and 5' to the ends of your strand. 5' 3' Direction of Replication

Four different pairs of PCR primers (in blue) are shown below. Each primer is shown in the location it would anneal to its template strand. Which primer pair would best amplify the target region?

In PCR amplification Why is it important to know the length of the sequence you amplify?

During PCR amplification in preparation for DNA sequencing, why were there different colors at the 3’ ends of the fragments produced? (What did these four colors represent?)

Explain why a positive control and negative control are included in PCR experiments. ​Explain the three steps involved in each cycle of polymerase chain reaction.Why is loading dye added to the DNA sample for gel electrophoresis? ​Explain the function of the following components in a PCR reaction:− Primer, dNTP, MgCl, Taq polymerase, buffer.

DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional  mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options:   More point mutations will arise in MER-minus yeast.   Fewer point mutations will arise in MER-minus yeast as compared with wildtype.   Of the total point mutations that…