short answers : c)Give an example of a common floating point arithmetic error due to the particular way in which floating point numbers are stored? d)Give an example of how when using C-strings and the functionstrcpy, things can go wrong.
Q: 4. Write a value-returning function, isVowel, that returns the value true if a given character is a…
A: As question no. is not mentioned I code both questions C++.
Q: Debug the following code in C++. This file is used to print integers from highest to lowest,…
A: The debugged code is provided in next step:
Q: 5.18 LAB: Count characters - functions Write a program whose input is a character and a string, and…
A: Create a 2 variable of type character and string Then take user input in main method After that…
Q: Design a function that accepts an integer argument and returns the sum of all the integers from 1up…
A: Algorithm Start int num Accept num from user sum=calculateSum(num) Print(sum) Stop. Function…
Q: 3.41 Write function lastF() that takes as input two strings of the form 'FirstName' and 'LastName',…
A: def lastF(FirstName,LastName):name="'"name=name+LastNamename=name+","+FirstName[0]+"'"return…
Q: for the following: Create a programmers defined function that will do the same as strlen…
A: As per guidelines, we can solve only one question at a time. Hence resubmit the question for further…
Q: Write a Python program that combines two dictionaries by adding values for common keys. Note: You do…
A: To write a python program to combine two dictionaries by adding values for common keys.
Q: formal language theory and computer programming, string concatenation is the operation of joining…
A: #include <stdio.h>#include <stdlib.h>#define MAX_CHAR 100 char* conscat_strings(char…
Q: 1- Write a function that finds the max of three numbers that are passed to it.
A: Step 1: input three user input number. Step2: Add three numbers to list. Step 3: Using max()…
Q: Code in C please. write a user defined function called pasttense that takes one argument a character…
A: logic:- In user defined function, calculate length of passed parameter. then fetch out last two…
Q: 6- Write a C++ function to check if a number is a float. The correct float number comes in any of…
A: I have provided C++ CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOT-------------
Q: Complete the function: int occurences(string s, char c){ Ilreturns the number of occurences of c in…
A: Requirement: Complete the given function occurences that takes a string and a character as argument…
Q: def can_vote(age: int) -> bool: """Return True iff age is legal voting age of at least 18 years. >»…
A: def can_vote(age:int)->bool: """return True if age is legal voting age of at least 18 years.…
Q: 5: Complete the function that takes in a number x, and returns the value 1 if x > 0, otherwise it is…
A: Logic:- within step_function use if else to check value of x is greater than or equal to 0 or not.…
Q: Fill-in-the-Blank Values that are sent into a function are called _________.
A: Argument
Q: Write a value-returning function in c++, isVowel, that returns the value true if a given character…
A: Code : #include <iostream>using namespace std; bool isVowel (char c) {if (c == 'a' || c == 'e'…
Q: Prompt the user to enter a string of maximum 100 characters. Note: the string can contain spaces.…
A: We can take string input in C using scanf(“%s”, str). But, it accepts string only until it finds…
Q: OTE: (what your answer will contain) -Use C PROGRAMMING LANGUAGE ONLY Use RECURSION type of program…
A: here in this question we have asked to write a c program which print Fibonacci series using…
Q: 2. Printing binary Write a function void printBin(int value) that will print an integer as a binary…
A: Here, I have to write a C program for the 2nd part Printing Binary.
Q: In c++ , perform data sorting using quick sorting. ( Drop code in words , explain the code and drop…
A: Quicksort picks an element as a pivot, and then it partitions the given array around the picked…
Q: 2. Printing binary Write a function void printBin(int value) that will print an integer as a binary…
A: Below i have coded and answered the required:
Q: Complete the C# function given below to remove the character at index i from the string str. public…
A: The complete is given below.
Q: A palindrome is a string that reads the same in its reverse. For example maam, wow, racecar, madam…
A: The code is written below for you problem: #include <string.h> // header files #include…
Q: 2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the…
A: In the Given question First, you have to write pseudo code for the given problem and then you have…
Q: c++ A palindrome is a string that reads the same both forward and backward. For example, the…
A: The below give C++ program will obey the following rubrics: Including necessary header files.…
Q: Write a MATAB function will return the distance between two vectors of arbitrary dimensions. Inside…
A: MATLAB CODE : % function to find the distance between the two city and also we validate % the…
Q: def can_vote(age: int) -> bool: "*"Return True iff age is legal voting age of at least 18 years. >>…
A: According to the question below the solution: Output:
Q: 1- How many arguments can a C++ function have? a) One. b) Two. c) Three. d) Unlimited 2- What is a…
A: INTRODUCTION: Here we see that there is multiple questions but according to guidance, only the first…
Q: 5- Write a group of statements that carry out the same action of upper and lower functions.
A: Your answer to write group of statement that carry same action of upper and lower function is given…
Q: 60- In the function, we pass the address of the variable as arguments when using --- O • Call by…
A: C++ program: C++ is a high level programming language. It is the extension of C program. It supports…
Q: 2. Printing binary Write a function void printBin(int value) that will print an integer as a binary…
A: so C program is given below that convert integer to binary number
Q: Proposed methodologies: Use Try & Catch. - C# - Visual Stideo
A: Create a function to calculate a square root for two real numbers and display it. Errors must be…
Q: 2. Printing binary Write a function void printBin(int value) that will print an integer as a binary…
A: Solution: Printing binary number from integer. #include <stdio.h> #include <stdlib.h>…
Q: (Time in Seconds) Write a function that takes the time as three integer arguments (forhours,…
A: Lets see the solution.
Q: Program 3: Write a value-returning function isVowel that returns the value true if a given character…
A: Aim: Write a value returning function isVowel to find if a character is a vowel or not. The program…
Q: What does the following function do? float hypot(float x, float y) { return sqrt(x*x+y*y); }//end of…
A: Given that: Find the result of the given function: float hypot(float x, float y) { return…
Q: (Replace strings) Write the following function that replaces the occurrence of a substring…
A: Program code: //include the header files#include <iostream>#include <string.h>using…
Q: 1- Write a function that takes a word less than 25 characters long and returns the letter that word…
A: Actually, program is an executable software runs on a computer.
Q: What does this function do? def f2(s): i=len(s)-1 whileți>=0): print(s[i].end="") i=i-1
A: D ) It prints the reverse of its parameter s ( Correct ) For more understanding , I have…
Q: 4. (Reverse a string) Write a function that reverses a string. The header of the function is:
A: PROGRAM INTRODUCTION: Take the string from the user. Call the function bypassing the original…
Q: the longest sequence of increasing numbers. Use the function: void longestSeq
A: Below the C program for the longest sequence of increasing numbers
Q: Q4.Write a C++ program that accepts a character as input data and determines whether the character…
A: Program: "//" used for comments // Include header files #include <iostream>using namespace…
Q: b) Good Programming practices help in improving programs readabilit and understandability both for a…
A: Programs: Programs are used to solve complex problems and to perform various tasks according to the…
Q: Computer Science code in c++ please .Do NOT use ANY string/character manipulation or…
A: Given The answer is given below.
Q: Write C++/C program, Create a function that accept string pointer and convert all capital case into…
A: Input Data : String data Output Data : Printing string by changing the case of all the characters…
Q: 2. Complete the C++ function given below, string filterDigits(string text){ //remove all digits from…
A: Iterate through the characters one by one Add one flag to point to the current position of the…
Q: 60- In the function, we pass the address of the variable as arguments when using • Call by Reference…
A: passing the variable address by using call be reference
Q: 2- Write a C++ function that accept one input argument only. The input could be a string, int, float…
A: Question 2. Write a C++ function that accept one input argument only. The input could be a string,…
Q: What is the issue with this function as defined? def double(): print (x*2) A numeric value must be…
A: Below is the answer to the above question. I hope this will be helpful for you..
short answers :
c)Give an example of a common floating point arithmetic error due to the particular way in which floating point numbers are stored?
d)Give an example of how when using C-strings and the functionstrcpy, things can go wrong.
Step by step
Solved in 2 steps
- (Numerical) Write a program that tests the effectiveness of the rand() library function. Start by initializing 10 counters to 0, and then generate a large number of pseudorandom integers between 0 and 9. Each time a 0 occurs, increment the variable you have designated as the zero counter; when a 1 occurs, increment the counter variable that’s keeping count of the 1s that occur; and so on. Finally, display the number of 0s, 1s, 2s, and so on that occurred and the percentage of the time they occurred.(Statistical) In many statistical analysis programs, data values considerably outside the range of the majority of values are simply dropped from consideration. Using this information, write a C++ program that accepts up to 10 floating-point values from a user and determines and displays the average and standard deviation of the input values. All values more than four standard deviations away from the computed average are to be displayed and dropped from any further calculation, and a new average and standard deviation should be computed and displayed.Python Language Useful websites: : http://en.wikipedia.org/wiki/Radix http://www.purplemath.com/modules/numbbase.htm Special Rules: Use only Boolean/math expressions and conditional statements (if-statements). Do not use built-in functions for converting integers into a string representation. Here to start with: kthDigit(x: int, b: int, k: int) -> int .........
- pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…C++ - When analyzing data sets, such as data for human heights or for human weights, a common step is to adjust the data. This can be done by normalizing to values between 0 and 1, or throwing away outliers. For this program, adjust the values by subtracting the smallest value from all the values. The input begins with an integer indicating the number of integers that follow. Ex: If the input is: 5 30 50 10 70 65 the output is: 20 40 0 60 55 The 5 indicates that there are five values in the list, namely 30, 50, 10, 70, and 65. 10 is the smallest value in the list, so is subtracted from each value in the list. For coding simplicity, follow every output value by a space, including the last one.
- C++. Strings and extended characters. String handling is standard functions - connecting lines, comparing, searching for characters, parts of lines search, change and delete. Task : Create a program that converts the given number in the binary system to the decimal system . A binary number is given as a string, and the result is a numeric value.Create a program in C language that calculates the month's day from a given year and year's day. Use pointers for the month and month's day variables. Don't forget to add proper errors handling in your program. Example or errors - Invalid Input- Invalid year- Invalid year day Example of input # ./month_day <year> <yearday> # Example for Feb 2nd, 2019:\$ ./month-day 2019 33Feb 02, 2019 I have this class - month-day.c - #include <stdio.h> /* month_day function's prototype*/void month_day(int year, int yearday, int *pmonth, int *pday); int main() {return 0;} Note: I don't need the calendar, please read the instructions well!!Exponent y Catherine Arellano mplement a recursive function that returns he exponent given the base and the result. for example, if the base is 2 and the result is 3, then the output should be 3 because the exponent needed for 2 to become 8 is 3 (i.e. 23 = 8) nstructions: 1. In the code editor, you are provided with a main() function that asks the user for two integer inputs: 1. The first integer is the base 2. The second integer is the result 2. Furthermore, you are provided with the getExponent() function. The details of this function are the following: 1. Return type - int 2. Name - getExponent 3. Parameters 1. int - base 2. int - result 4. Description - this recursive function returns the exponent 5. Your task is to add the base case and the general case so it will work Score: 0/5 Overview 1080 main.c exponent.h 1 #include 2 #include "exponent.h" 3 int main(void) { 4 int base, result; 5 6 printf("Enter the base: "); scanf("%d", &base); 7 8 9 printf("Enter the result: ");…
- Data Structures the hasBalancedParentheses () method. Note: this can be done both iteratively or recursively, but I believe most people will find the iterative version much easier. C++: We consider the empty string to have balanced parentheses, as there is no imbalance. Your program should accept as input a single string containing only the characters ) and (, and output a single line stating true or false. The functionality for reading and printing answers is written in the file parentheses.checker.cpp; your task is to complete the has balanced.parentheses () function. **Hint: There's a pattern for how to determine if parentheses are balanced. Try to see if you can find that pattern first before coding this method up.Programming Language = Python 3. Recursive Lines Write a recursive function that accepts an integer argument, n. The function should display n lines of asterisks on the screen, with the first line showing 1 asterisk, the second line showing 2 asterisks, up to the nth line which shows n asterisks. Sample Output A AA AAA AAAA NOTE: Print A NOT * character as an output for n.C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: N