SEMI-DISCONTINUOUS REPLICATION New strand synthesis always in the 5’-3’ direction a 3 3 Leading strand Lagging strand with Okazaki HO. fragments 15 3 13 5 S-3 OH HO 00 3. Most recently synthesized DNA Sugar 15' 3' HO 00 13' 5 Base 5' triphosphate 3

Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but

Please explain in depth i don't understand

Pues (two-ringed) 9. (a) Label each nitrogenous base in the double strand of DNA in Figure 4. NEL P-C.₂. H- (a) -CH₂-P-C₂ 5' 0 PCH₂ (b) -Н -CH₂-P-C₂ 5' 0 PCH₂ CH₂-P-C₂ H 0 I' P 5' 0 (d) 3' CH₂ H PCH₂ Figure 4 (b) Figure 4 above shows a phosphodiester bond. Explain what this is. 1.5 Pr

ans fast I will Upvote

ment Lopez Chun 1 1006 is Diego 5. For the following DNA strand, complete the following: a. Write the complementary DNA strand below the strand. 5'-A CCTA CGTTC GACGTA ACCGCAT T-3' 3-T6G AT GCAAG CTGCATT GG C6TAA_5² b. Replicate the DNA strand (remember semiconservative replication). 5'-AC CTA CGTTCGAC GTAA CCGCATT-3' 3'- 5'- 3'- 5'-ACCGTTCGACGTAACCGCATT-3' - 5' 138 DNA and BLAST Lab Report - 3' - 5' OLD NEW NEW OLD c. Transcribe the 5' to 3'DNA to an mRNA strand (remember there is NO thymine in RNA). 5'-A CCTA CGTTCGACGTA ACCG CATT-3' DNA mRNA d. Take mRNA strand and convert to amino acid (protein) using mRNA codon table (Table 4). Remember mRNA is read 5' to 3' so you will need to re-write the sequence to begin with the 5'end. Start protein at the AUG sequence. mRNA Protein

List the steps (and the major enzymes in each step) involved in DNA replication

of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆

EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'   Number of pieces of DNA , and type of fragment .

Σ 00 IN T LL II # m duplex appears in the duplex formed in replication. none most Ohalf Ohardly O any all QUESTION 4 If we repeated the Messelson Stahl experiment but we started with N4N4 then transgressed to NTON15 book, there they started with N (please note, this is not like what is in the. 15 and went to N14) and waited for 2 generations, we will see the following bands density-gradient centrifugation: O a single band of DNA with medium density. O one band of heavy DNA and one band of DNA with medium density. O one band of light DNA and one band of DNA with medium density. Othree bands corresponding to DNA of light, medium and heavy density. O one band of heavy DNA and one band of light DNA. QUESTION 5 Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All A 73°F Rain off and or F1 F2 F3 F4 F5 F7 F8 F10 F12 PrtScr V 2 5. 7. 4. G K. 7 H. B Alt Ctrl