Slide 14Please help me explain this on my report on cell dogma SEMI-DISCONTINUOUS REPLICATIONNew strand synthesis always in the 5'-3’ directionaLeading strandLagging strandwith OkazakiOHfragments1513'05S.3OHHOoo3.SugarMost recentlysynthesizedDNA15'5h33' HO3%13'Base5' triphosphate

Some of the pictures are colored for your better understanding.

SEMI-DISCONTINUOUS REPLICATION New strand synthesis always in the 5’-3’ direction a 3 3 Leading strand Lagging strand with Okazaki HO. fragments 15 3 13 5 S-3 OH HO 00 3. Most recently synthesized DNA Sugar 15' 3' HO 00 13' 5 Base 5' triphosphate 3

SEMI-DISCONTINUOUS REPLICATION New strand synthesis always in the 5’-3’ direction a 3 3 Leading strand Lagging strand with Okazaki HO. fragments 15 3 13 5 S-3 OH HO 00 3. Most recently synthesized DNA Sugar 15' 3' HO 00 13' 5 Base 5' triphosphate 3

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Related questions

Q: 1- 50 μη (A) Identify the organism

A: A protist is a eukaryotic organism.Term protista was given by Ernst Haeckel.Main characteristics of…

Q: Although this organism is a normal resident of the skin microbiota, it can cause infections…

A: A common resident of the skin microbiota is the bacterial species Staphylococcus epidermidis.…

Q: T T T F F F During the three subphases, the cell grows by producing proteins and cytoplasmic…

A: As per our guidelines we are not allowed to answer more than three ture and false at a time please…

Q: Question #1. Chemical substances causing developmental abnormalities in the organism. Question #2.…

A: Various chemical agents, alcohol, drugs of abuse, and even some prescribed medications are highly…

Q: Question 15 Simple columnar cells are found in the skin muscle O gastrointestinal tract

A: We know that Columnar epithelial cells are simple epithelium made up of columnar cells. They are…

Q: Please answer fast The current therapies available to treat CF only treat the symptoms of the…

A: Introduction :- Cystic fibrosis (CF) is a genetic disease that affects the lungs, digestive system,…

Q: What is Zellweger's syndrome?

A: Zellweger's syndrome is known as cerebrohepatorenal syndrome.

Q: Lab #3 Part B Comparison Specimen 2 and 3 with Exemplar 1.

A: A Comparison of Glass Specimens is the Subject of the Analysis of Lab #3 Part BIn the first picture,…

Q: its corresponding Main part. Identify three (3) Biologists with their respective work where…

A: A microscope is a laboratory experiment which is used to view the details of the objects which are…

Q: Question 8 Mycobacterium leprae infects which cell and cause demyelination and other peripheral…

A: Most of the motor neurons are myelinated. Presence of myelin sheath on the axons of the neurons…

Q: End

A: In anatomy, the head portion is known as the cephalic region consisting of all the head regions.…

Q: In making an artificial cell, the plasma membrane is represented by ____________ _____________.

A: Artificial cell is that synthetic arrangement of particles which together mimics an actual…

Q: Question 2 Describe the colonies as they appear on the Streak Plate. Edit View Insert Format Tools…

A: The streak plating method is used to isolate the single type of bacterial species on a plate. The…

Q: 9. The cilia a. are microfilaments b .Are microtubules c. Presents in respiratory cells d. paralysed…

A: Introduction: Cilia are the hair like projections on the outer surface of the epithelial cells.

Q: Single celled; found mostly in extreme environments This domain includes most of the single- celled…

A: Introduction Most all life on the globe begins as a single-cell organism since the cell is the…

Q: To expose bacteria to antibiotics, the bacteria were sprayed with a streptomycin solution…

A: Antibiotics are simply chemicals that kill prokaryotic cells but do not harm eukaryotic cells. They…

Q: Your medical care team determines that a third patient's severe illness is caused by a helminth.…

A: STH : Soil transmitted helminthiasis (Hookworm, roundworm or whipworm) Diagnosis by Kato-katz…

Q: You are asked to recommend an antibiotic to treat potential pathogenicityt in an animal. Describe a…

A: Antibiotics -- Antibiotics are substances obtained from plants naturally or artificially prepared to…

Q: Antibiotic resistance might be assumed if 1. bacterial colonies are present on a streptomycin…

A: Often antibiotics are used to treat diseases that occur in various life forms. They inhibit…

Q: Select one: O a. stomach O b. spleen Oc. small intestine O d. pancreas

A: The given first diagram shows the human digestive system. The second picture shows the part of…

Q: Question 7 Which statement about the use of a suffix in a medical term is correct? It is placed at…

A: There are three basic part for a medical term. Prefix, root and Suffix. Prefix is the beginning of…

Q: Please help me with this questions. I provided an example on how it has to be done. I don’t…

A: A gene is a genetic unit that is arranged in thousands on the strands of DNA (deoxyribonucleic acid)…

Q: Please help me answer how much volume of cell suspension needed (for 5*10^4 cells) in microliters.…

A: For some experiments, it is essential to use the specified number of cells of microbes (or…

Q: Please help me with the following question: Von Willebrand disease is an inherited bleeding…

A: Von Willebrand disease is a chronic bleeding disorder that causes your blood to clot improperly.…

Q: Protein synthesis is also known as Blank 1 Blank 1 Add your answer

A: Introduction Organisms are made up of proteins. Proteins have a high nutritional value and are…

Q: 2. Scientist whom made the cell theory..

A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering the first…

Q: QUESTION 4 Capsids: are a form of viral envelope are made up of capsomers contain prophages never…

A: Capsids are the protein coat that are present in viruses. It functions to protect viral genome from…

Q: Question 20 Culture media must be: A agar B) sterile c) selective D chemically complete

A: Culture media must be agar. Agar is widely used as a culture medium for growing micro-organisms.…

Q: So who gets the money? Justify your answer.

A: DNA (deoxyribonucleic acid) paternity testing is used to determine the biological parent of an…

Q: have been HIV-positive for the past 10 years. Physical examination now shows multiple reddish…

A: Kaposi sarcoma is the commonest manifestation of patients suffering from AIDS. It's caused due to…

Q: question 11 Explain the role of streptomycin in the lab. 1. Streptomycin was the bacteria to which…

A: Antibiotics are the medications that are used to treat bacterial diseases

Q: In my homework this solution was wrong. Could there be another option for this question?

A: Epidemiology is the branch of medical science that deals with the study of illnesses in communities…

Q: Answer the following, 3-5 sentences. Define cell membrane and explain some important roles cell…

A: Introduction A Cell Is The Structural And Functional Working Unit Of Life, As Well As An Organism's…

Q: Hematoxylin is a cytoplasmic stain O true O False

A: Introduction The most basic reason that cells are stained is to reinforce visualization of the cell…

Q: the vacuum is very important stage during electron microscope operation O true O False

A: Electron microscope is one of the most widely used instrument in laboratories. With the help of…

Question

Slide 14

Please help me explain this on my report on cell dogma

SEMI-DISCONTINUOUS REPLICATION
New strand synthesis always in the 5'-3’ direction
a
Leading strand
Lagging strand
with Okazaki
OH
fragments
15
13'
05
S.3
OH
HOoo
3.
Sugar
Most recently
synthesized
DNA
15'
5h
3
3' HO
3%
13'
Base
5' triphosphate

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 7 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
JILLule should [1] De Tepicated exactly. Figure 2 represents part of a DNA molecule. 5'TT ATGC TT 3' T. C CA G tal: 5] TACG A A G 3' GTC her 5' Figure 2 (c) Show, by means of annotated diagrams, how this piece of DNA is replicated. Distinguish clearly between the original and new strands.
5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but
Please explain in depth i don't understand
optons to all 3 drop down menus are: 1. bottom strand 2. right to left 3. both right to left and left to right 4. left to right 5. top strand
Pues (two-ringed) 9. (a) Label each nitrogenous base in the double strand of DNA in Figure 4. NEL P-C.₂. H- (a) -CH₂-P-C₂ 5' 0 PCH₂ (b) -Н -CH₂-P-C₂ 5' 0 PCH₂ CH₂-P-C₂ H 0 I' P 5' 0 (d) 3' CH₂ H PCH₂ Figure 4 (b) Figure 4 above shows a phosphodiester bond. Explain what this is. 1.5 Pr
ans fast I will Upvote
to 4 minutes) The schematic diagram below shows organization of the DNA replication fork. Match parts of the diagram (labeled A-F) with the corresponding term from the answer list (designated 31 parental duplex 5' 3' fork progression v A 1Lagging strand 2. An Okazaki tragment 3.Site of action of DNA topoisomerase 4 Leading strand 5. Site of action of DNA helicCase 6.Site of action of DNA ligase
ment Lopez Chun 1 1006 is Diego 5. For the following DNA strand, complete the following: a. Write the complementary DNA strand below the strand. 5'-A CCTA CGTTC GACGTA ACCGCAT T-3' 3-T6G AT GCAAG CTGCATT GG C6TAA_5² b. Replicate the DNA strand (remember semiconservative replication). 5'-AC CTA CGTTCGAC GTAA CCGCATT-3' 3'- 5'- 3'- 5'-ACCGTTCGACGTAACCGCATT-3' - 5' 138 DNA and BLAST Lab Report - 3' - 5' OLD NEW NEW OLD c. Transcribe the 5' to 3'DNA to an mRNA strand (remember there is NO thymine in RNA). 5'-A CCTA CGTTCGACGTA ACCG CATT-3' DNA mRNA d. Take mRNA strand and convert to amino acid (protein) using mRNA codon table (Table 4). Remember mRNA is read 5' to 3' so you will need to re-write the sequence to begin with the 5'end. Start protein at the AUG sequence. mRNA Protein