Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Fill in the blanks
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardMatch Column A (Description) with Column B (protein/enzyme). unwinds the double helix of DNA in replication makes a short section of RNA to act as a primer links separate stretches of DNA stabilizes the unwinding of the helix relieves the tension in the double stranded DNA (dsDNA) facilitate the switching on of genes…arrow_forward
- Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.arrow_forwardBelow is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes MRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Promoter MRNA RNA TRNA region polymerasearrow_forwardBelow is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes mRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Answer Answer Answer Answer Promoter region mRNA RNA polymerase tRNAarrow_forward
- Refer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .arrow_forwardB. Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet to find the sequence of the amino acids coded for. T A C C A T G A G A A T T G T G G T C A C C T T T T T – sense strand A T G G T A C T C T T A A C A C C A G T G G A A A A A – antisense strand mRNA: Amino acid: Question: 1. If the nucleotide at position 23 in the first strand of DNA is changed to "A", what effect would this have on the protein produced?arrow_forwardb) Use the DNA sequence bęlow to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence.arrow_forward
- Use the terms provided to label the diagram representing the flow of information from DNA to protein. Messenger RNA Translation Polypeptide Codon Transcription DNA template strand DNA coding strand Amino acid ++ !!!! 4arrow_forwardConvert the DNA template to mRNA. Then,convert the mRNA to tRNA. Based from theresulting sequence in the anticodons of tRNA,determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code.1. DNA Template: TAC-GGC-TAC-CAT-ATG-GAGmrNa:tRNA:Amino acid sequence: 2. DNA Template: TTA-CAT-CAT-ATC-GAT-GACmrNA:tRNA:Amino acid sequence: 3. DNA Template: CTA-GCG- ATA - AAA-TTT-ATTmrNa:tRNA:Amino acid sequence:arrow_forward1) Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the complementary base pairs for a single strand of DNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning