QUESTION7 Tine has type O blood and her sister Rose hes type All blood. What are the blood genotypes their parents must have? (Assume they are homozygous now loous) a. Can not be determined from given Information. Ob |A| BB Oc O d. O e. Parent 1: Parent 2: Parent 1: Parent 2: AB Parent 1: i i Parent 2: Parent 1: Parent 2: Bi Ai Bi
Q: Describe the relevance of Bioinformatics in supporting the progress of Biotechnology.
A: Bioinformatics: Short for "biological Informatics", Bioinformatics is a new field of biotechnology…
Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.
A: DNA extraction: The process of extraction of DNA from the cell can be done by various methods.…
Q: Discuss the different methods of measuring onions and citrus physical characteristics/properties and…
A: Onion and lemon are two of the most important agricultural product in the globe. These two also fall…
Q: What is the most likely mode of inheritance? b) If this were a pedigree you did NOT want to…
A: * There are four types of pedigree. They are X linked recessive X linked dominant Y linked…
Q: Pasteur used an S-necked flasks to disprove spontaneous generation. Explain the experiments that…
A: Spontaneous generation is a hypothesised theory that attempted to explain the origin of life…
Q: In cucumbers, speckled fruit color (u') is dominant to uniform fruit color (u), and large spines…
A: Given Speckled fruit colour U+ is dominant to uniform fruit colour u Large spines SS+ is dominant…
Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…
A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…
Q: Organisms have the following genotypes. What types of gametes will these organisms produce, and in…
A: Introduction : All sexually reproducing organisms have sex cells called gametes. The gamete produced…
Q: reduces
A: C.reduce ,unfolds. Due to their covalent nature disulfide bonds can have profound effects on the…
Q: If a goose with genotype Aa had migrated instead of the goose with genotype aa, would the scenario…
A: The movement of genes into or out of a population is referred to as gene flow. Such movement may…
Q: What would most likely happen if you experimentally delete the signal sequence of a prospective…
A: mRNA and the ribosome work together to generate a specific protein during protein translation.…
Q: In fruit flies, red eye color (R) is dominant over brown eye color (r). Two red-eyed fruit flies…
A: The offspring of two parents can be different from both parents as new allelic combinations can be…
Q: Cat DNA is much more similar to dog DNA than to tortoise DNA. Why? (a) Cats and dogs are both…
A: All living things have the same genetic material (DNA), comparable genetic codes, and the same…
Q: C -B اصليين انا A
A: Some cells, such as unicellular bacteria and protozoa, are complete creatures; others, such as…
Q: If an individual has a genotype of RR, what would be the possible genotype(s) of the gametes…
A: In a diploid organism, two alleles for a particular gene are expressed & combine to produce…
Q: In a population, which individuals are most likely to survive and reproduce? (a) The individuals…
A: Population means individuals of people of the same species living in the same environment or area.…
Q: Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.
A: Evolution is the gradual shift in the inherited traits of natural populations over many generations.…
Q: Which of the following would be a properly identified and acceptable specimen? 1. needle biopsy…
A: The properly identified and acceptable specimen may include: needle biopsy with patient's medical…
Q: Calculate the total number of bacteria in your yogurt container three times (in duplicate). Begin by…
A: Colony forming unit: A colony-forming unit is used to determine the number of viable microbial…
Q: development of the genetically engineered foods (genetically modified organism or GMOs)? Find…
A: Genetically modified organisms are organisms in which the genetic material has been altered in a way…
Q: 4) Researcher #1 and #2 in your lab each conducted a protein purification. They present you with the…
A: INTRODUCTION Methods of protein purification Electrophoresis Gel electrophoresis Affinity…
Q: Instructions Match the letters that describe the process with the numbers in the Venn Diagram. Each…
A: Here are the matches
Q: Why do vestigial structures still exist if they are no longer useful?
A: Anatomical structures in an organism that are deemed to have lost most or all of their primary…
Q: Based on these sequences, how do you decide decided which fragments were the beginning, middle, and…
A: There are three fragments given in the question. The three fragments can be aligned on the basis of…
Q: Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What…
A: Introduction : A microorganism is an organism too small to be seen by human naked eyes.…
Q: In a population of 50 hamsters, 60 of the alleles code for brown fur and 40 alleles code for black…
A: If the allele and genotype frequencies remain same generation after generation then we can say that…
Q: Can simple technique be used to identify more than the morphological characteristics of…
A:
Q: Describe how a nuclear protein is made and transported to its final destination.
A: Proteins are 3-dimensional structures that are involved in various functions in our body. Proteins…
Q: Which of the following would inhibit the function of the JAK-STAT Pathway? Multiple answers A.…
A: JAK-STAT pathway is activated in response to cytokines (interferons and interleukins). The receptor…
Q: The allele for albinism is recessive to the allele for normal skin pigmentation. All individuals who…
A: An inherited disorder that presents with little or no melanin production, which results in either…
Q: Answer it. In Seminal Fluid Analysis, what are aspects of semen that are assessed microscopically?
A: Sperm The male gamete that is motile and fertilize female gamete.
Q: hierarchical/levels of organization in ecology.
A: Introduction Ecology is the scientific study of the distribution and abundance of organisms, as…
Q: Why are convergent traits considered evidence for evolution
A: Convergent evolution is the independently occurring evolution of comparable traits in animals from…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: Question 9 of 14 Which of the following acts as a signal for the dendritic cell to begin…
A: Cross-presentation is the process by which specific MHC class I-expressing professional…
Q: Traits that are inherited and improve an individual’s ability to survive and reproduce are called…
A: Traits are defined as the idenfying character of an individual carrying several genetic…
Q: Please answer fast which modern tecniques used in following countries for the production of…
A: Modern agricultural techniques are farming techniques that include a lot of labor, huge financial…
Q: Cells that line your intestines are specialized for nutrient absorbtion and are known to possess…
A:
Q: 1. You accidentally used safranin as the primary stain and malachite green as the counter stain…
A: A stain is a chemical substance used in the laboratory to add color to the cell. This is used for…
Q: Q1: What is natural selection selecting for here? Q2: Why do bacteria that are not genetically…
A: Natural selection is the process in which the environment selects its organism naturally depending…
Q: What are the similarities and differences between schistosoma ans taenia solium?
A: Taenia solium An organism that belongs to the group of playtyhelminthe. These organism are mostly…
Q: Explain how plants make organic molecules. Include the terms CO2, H2O, photosynthesis, sugar, and…
A: Plant synthesized organic molecule Glucose by using CO2, H2O & sunlight through the process of…
Q: Discuss at least 3 cardiovascular diseases (CVD) risk factors that can be modified. How do factors…
A: Introduction Cardiovascular diseases CVD also called as coronary artery disease is caused due to the…
Q: What is a wet mount technique in microscopy?
A: Microscopy is the technical field of using microscopes to view samples and objects that the naked…
Q: What is the importance of the GUS gene? Why is using GUS with Arabidopsis thaliana important ?…
A: Explanation: Beta-glucuronidase is an enzyme that plays a role in the breakdown of plant cell…
Q: What account for the reduction of levels of soluble carbohydrate and nitrogen of vegetation and…
A: As cattle production rises in America, Africa, and Asia1, grassland lands are becoming more crucial…
Q: In the late 1900s, two populations of bubble guppies became isolated from each other when a tsunami…
A: Introduction :- Temporal isolation happens when two populations reproduce in distinct seasons or at…
Q: Discuss at least three methods of DNA extraction and summarize each methods using a schematic…
A: DNA extraction is a technique to separate DNA from cell membranes, proteins, and other biological…
Q: The mouth is part of our digestive system. It would make sense then, that we would have more of the…
A: Cells are dynamic in the sense that they employ energy to accomplish a range of cell tasks such as…
Q: If the two populations in question 2 are determined to still be the same species, did allopatric…
A: The mechanism through which populations develop into different species is known as speciation. In…
Step by step
Solved in 2 steps
- A couple believes that they have brought the wrong baby home from the hospital. The wife is O, husband is B and the child is O. Could the baby be theirs? Support your answer. An additional test disclosed the husband and wife to be both Rh’, whereas the baby is Rh-.Does this added fact change your judgment?Anika is pregnant with her first child. Her paternal grandfather had hemophilia. Her partner Ethan's maternal uncle also had hemophilia. What is the probability that their child will have hemophilia? O 1/64 O none of the above O 1/32 O 1/96 O 1/24 1/6 O 1/48 o ooo o o o O1. Subject A is 5'8" tall and weighs 161 pounds. Her BMI is ______ kg/m2.
- There is two images, question 2 is the case study and I need the answer for question 3.Table 4: Presence or Absence of Agglutination Mother 1 Father 1 Child 1 Mother 2 Father 2 Child 2 Mother 3 Father 3 Child 3 Anti-A Sera Agglut No Agglut No No No Agglut No Agglut Anti-B Sera Agglut No No No Agglut Agglut No No No Anti-Rh Sera No Agglut Agglut Agglut No Agglut No No No Select: Select: Select: Select: Select: Select: Select: Select: Select: Blood TypeMrs. Xexy Lucero, G1PO, 40 weeks AOG was ordered by the health care provider a Contraction stress test (CST) whose nonstress test (NST) was nonreactive. Which maternal complications should alert Nurse Zasha to question the order? Select all that apply. a. Incompetent cervix b. Premature rupture of membrane c. Preterm labor d. Hypertension e. Drug addiction
- a https://www.liveworksheets.com/oq1336503xg Fill in the Punnett Square below. The first box is done for you. b b bb ch 4x O E 近Maternal anemia occurs when a pregnant woman has a hematocrit Multiple Choice O O O below 60% below 33% below 45% below 50%Please answer the questions Blood Typing Lab A. Please answer the following questions and provide a hand drawn or internet picture for each: i. Sally's blood type is A. Please design a blood test to verify her blood type. ii. John's blood type is B. Please design a blood test to verify his blood type. iii. Sue's blood type is AB. Please design a blood test to verify her blood type. iv. Joe's blood type is O. Please design a blood test to verify his blood type. v. Mary's Rh factor is positive. Please design a blood test to verify her Rh factor. vi. Paul's Rh factor is negative. Please design a blood test to verify his Rh factor. ELISA Simulation Lab A. Please make sure you know the difference between an indirect vs. a direct ELISA. i. Please make sure you know the sources of the antibodies and antigens in the indirect and direct ELISA tests. ii. What are monoclonal antibodies? Fungal Lab A. Please provide diagrams, significance and benefits (medicinal…
- Mrs, Zexy Lucero, 25 years old, G1P0, in the first trimester of pregnancy arrives at a health care clinic for prenatal check-up. What information should Nurse Zasha include when counseling her about human immunodeficiency virus (HIV) testing? (Select all that apply) a. Risks of passing the virus to the fetus b. Requirement that pregnant women are tested for HIV c. Meaning of positive or negative test results d. Disclosure of risk factors for contracting HIV e. Emotional, legal, and medical implications of test resultsPlease help me to answer ALL the letters with the correct answer. NO MORE EXPLANATION1. What should be the initial nursing action after the birth of a preterm infant with an Apgar score of 6. A. check and clamp the umbilical cord B. dry the infant and place in a warm environment C. obtain a footprint and apply ID band D. get resuscitative equipment and assist the doctor 2. A baby is born with hyperbilirubinemia. The mother is asking yo. "Why is my baby's skin is yellow?" As a nurse you will explain this by saying: A. the spleen and the livers an attempt to destroy damaged blood cells B. as red blood cell is destroyed, indirect bilirubin is released C. there is depression of the bone marrow, resulting to decrease RBC D. ucoronyl transferase is too many that it prevents conversion of bilirubin 3. SGA newborns are at risk for difficulty in thermoregulation. As a nurse how can you best explain this to their parents. A. They are preterm so they are born relatively small in size B. They…17. Parents Jacob and Emma have had two children, Samuel and Matthew. Baby Samuel died at the age of nine days. When baby Matthew has trouble feeding, his parents take him in to the doctor. He is diagnosed with Maple Syrup Urine Disease (MSUD), a life- threatening condition in which the patient is not able to break down proteins from their food. As Matthew receives treatment, Jacob and Emma are referred to a genetic counselor. The genetic counselor collects information about their family. Neither of Jacob's parents were affected by MSUD. Jacob had one brother and three sisters. One of these sisters died shortly after birth. Similarly, neither of Emma's parents were affected by MSUD. Emma had four brothers, and two of these died shortly after birth. a. Given what you know about Jacob and Emma's family, construct a pedigree that includes all three generations. b. Based on the pedigree you constructed, is it likely that MSUD is caused by a dominant allele or recessive alleles? How can you…