Answered: Cells that line your intestines are…

Cells that line your intestines are specialized for nutrient absorbtion and are known to possess numerous membrane proteins that transport small molecules and ions across the plasma membrane

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter3: Cell Structure

Section: Chapter Questions

Problem 3DID

See similar textbooks

Related questions

Q: What is definition as used in microscopy?

A: Introduction A microscope is an instrument that makes an enlarged image of a small object, thus…

Q: Possible answers for each: A) Both hormone and a neurotransmitter. B) Hormone. C) Neurotransmitter.…

A: Hormones only work once they "fit" a part of the body. That is, if cells within the target…

Q: The fossil record shows that the ﬁrst mammals evolved 220 million years ago. The supercontinent…

A: Fossils are the remains of ancient or former living organisms whose biological evidence suggests…

Q: Why does a fiber ( double stranded molecule or duplex) of DNA shorten upon drying?

A: DNA The double helical structure present inside the nucleus.

Q: Unlike natural selection, is not related to an individual’s ability to survive and may result in…

A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…

Q: Describe primary and secondary active transport in detail

A: transportation in cell In biology, there are two mode of transport systems in the cell which…

Q: 8. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…

A: A buffer system is important for a living thing as it helps to maintain a constant chemical internal…

Q: 5) What term is used to describe when two solutions have reached a balanced state? Isotonic…

A: Body fluids are those natural fluids present in the body through which the substances necessary for…

Q: When a population evolves to be better ﬁtted to its environment, this is an example of , which is…

A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…

Q: Identity gene 1 (bl, pr, vg) Identity gene 2 ( bl, pr, vg) Identity gene 3 ( bl,pr, vg) How many map…

A: The three point test cross is used in this table. The greater numbers are parental progenies. The…

Q: What is a wet mount technique in microscopy?

A: Microscopy is the technical field of using microscopes to view samples and objects that the naked…

Q: when carrying the microscope, why should one hand hold the bottom of the base?

A: A microscope is a laboratory instrument used to examine objects that are too small to be seen by the…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: sIMILARITIES AND DIFFERENCES ecologist vs. environmentalist

A: Differences between ecologist and environmentalist: I) Ecologists are those who study ecology i.e.…

Q: Humans with gene "R" are 25% more likely to survive tuberculosis than humans with gene "S." What…

A: Tuberculosis (TB) infection is caused by the bacteria Mycobacterium tuberculosis. It is one of the…

Q: Draw an aquatic food chain with at least one producer ane 3 animals make sure to point arrows in the…

A: In the ecosystem different species interact with each other and form an ecological community. The…

Q: There are two ways in which rearrangement of domain- encoding gene segments can result in novel…

A: Introduction Prokaryotes: These are the organisms which have characteristic nucleoid rather than…

Q: What is the role of the mannose-6-phosphate (M6P) group? • What happens when M6P cannot be…

A: Mannose-6-phosphate is a molecule bound by lectin in the immune system. M6P is converted to fructose…

Q: Rank the following taxonomic groups, from greatest global species diversity (1) to least global…

A: How many species are there on Earth? Conservative and scientific estimates made by Robert May place…

Q: If you wanted PCR to be successful but only had access to a thermolabile DNA polymerase, what would…

A: PCR - Polymerase chain reaction, is a process where DNA copies are amplified by a cyclic chain…

Q: Domain(s) Presence of a nucleus Location of DNA Number of organelles Cell wall material Type of cell…

Q: Results of movement of the bubble in respirometer What information did the movement of the bubble…

A: Cellular respiration The process by which energy is produced inside the cell.

Q: The A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30.…

A: DNA is the molecule that carries the genetic information for an organism. It is basically made up…

Q: How long does it take for a bacterial culture with a generation time of 12 minutes to increase from…

A: The generation time is the time taken by a bacterial cell to divide. That means it indicates the…

Q: researchers discover a new compound, known as Serenity, which has been shown to be effective at…

A: Anxiety is a kind of an actual or escalated threat to Survival or well being which is induced in an…

Q: Protein and amino acids are not the preferred source of energy in the body since proteins are used…

A: Proteins are biomolecules composed of amino acids. Carbohydrates, proteins, lipids and nucleic acids…

Q: Summarize the location of the heart in the human body

A: Introduction The physical component of the human organism, the human body is made up of…

Q: Give similarities and differences between the following: a. ecologist vs. environmental scientist b.…

A: Ecology is the study of the relationship and interactions of different components of a habitat. The…

Q: Which of the following processes and or mechanisms of evolution violate the assumptions of…

A: A population must satisfy five key suppositions in order to be in Hardy-Weinberg equilibrium, or a…

Q: 1. Phenylethyl alcohol (PEA) agar is a selective media. Which of the following organisms should NOT…

A: The comprehensive research of microorganisms, whether they have one cell, many cells, or are…

Q: What makes an experiment controlled?

A: Scientists test their hypotheses using controlled experiments. A hypothesis is an assumption, an…

Q: How are the "types ot veterbrae" modified in birds, relative to other amniotes?

A: Many variables influence the survival or extinction of an organism's population. On the other hand,…

Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…

A: Introduction The contour of biological regulation:- It is a way for information processing &…

Q: Based on these sequences, how do you decide decided which fragments were the beginning, middle, and…

A: There are three fragments given in the question. The three fragments can be aligned on the basis of…

Q: Write the species for the following:

A: The species is a taxonomic rank in biological classification that includes all the organisms which…

Q: orange [yr] snap dragon is of a cross between a yellow [yy] snap dragon and a red[rr] snap dragon…

A: When neither trait is truly dominant over the other, incomplete dominance results. This implies that…

Q: You are constructing a phylogeny of a hypothetical group of insects. Several of the ingroup species…

A: Introduction The study of relationships among distinct groupings of species is known as phylogeny.…

Q: In the cells of honey badgers, DNA can be found in which compartments: Select one: a. cytosol b.…

A: DNA is the abbreviated form of the nucleotide polymer deoxyribo nucleic acid. It is the genetic…

Q: The girl is focusing a slide and she is turning the coarse adjustment knob up toward the slide. A.…

A: An optical microscope has the following parts:- A stage for placing the slide A set of objective…

Q: Discuss the effects of isotonic, hypotonic, and hypertonic environments on red blood cells and plant…

A: Osmosis is the net movement of water across a semipermeable membrane.

Q: Why are the protein receptors on the egg cell particularly important among aquatic animals that use…

A: Fertilization is the process in which intermingling of male and female gamete fuse together and form…

Q: In allosteric activation_ O the substrate only binds to the low affinity enzyme. the effector binds…

A: Allosteric In enzymes whenever a molecule other than substrate bind it other than active site than…

Q: features that suggest the Cnidaria and Ctenophora share. Outline the features that distinguish these…

A: Cnidaria and Ctenophora are two phyla belonging to the kingdom Animalia. Cnidarians are named so…

Q: cl II III IV 1 2 2 3 4 2 E) I II III IV S 3 D) I II HI IV 1 85 8 2

A: Introduction : Pedigree charts are family trees that show the members of a family who have been…

Q: use of secchi disc in ecology

A: Ecology is the study of the relationship between the living and non-living components of the…

Q: The endplate potential decreases with distance because

A: The end plate potential is a potential that propagates to the neighbouring patch of muscle fibre…

Q: Describe the properties of the cell membrane, how it works, and why it is essential for the cell.

A: The cytoplasm of a cell is encased by the multilayered membrane known as the cell membrane. Along…

Q: Similiarities and differences: ecology vs environmentalism

A: The environment is very important in life. It is a necessary element of our lives. A clean…

Q: The main products of yeast fermentation are (Check all that apply)

A: The main products of yeast fermentation are ; 1. Alcohol ( ethanol ) 2. CO2 ( carbon dioxide ) 3.…

Q: Which statement is the most accurate? All life is made of cells - no exceptions Most life is made of…

A: Prokaryotes:- the living organisms devoid of true nucleus are called as prokaryotes. These organisms…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

100%

Cells that line your intestines are specialized for nutrient absorbtion and are known to possess numerous membrane proteins that transport small molecules and ions across the plasma membrane. Which of the following cell structures would you expect to be required for this function of the cells? The endoplasmic reticulum Lysosomes Peroxisomes or Cell walls

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Organelles and Cystic Fibrosis A plasma membrane transport protein called CFTR moves chloride ions out of cells lining cavities and ducts of the lungs, liver, pancreas, intestines, and reproductive system. Water that follows the ions creates a thin film that allows mucus to slide easily through these structures. People with cystic fibrosis (CF) have too few copies of the CFTR protein in the plasma membranes of their cells. Not enough chloride ions leave the cells, and so not enough water leaves them either. The result is thick, dry mucus that clogs the airways to the lungs and other passages. Symptoms include difficulty breathing and chronic lung infections. In 2000, researchers tracked the cellular location of the CFTR protein as it was being produced in cells from people with CF (Figure 3.13). Figure 3.13 Cellular location of the CFTR protein. Graph compares the amounts of CFTR protein found in endoplasmic reticulum, vesicles travel in g from ER to Golgi, and Golgi bodies in CF cells and normal cells. Which organelle contains the least amount of CFTR protein in normal cells? In CF cells?
The plasma membrane __________. a. surrounds the cytoplasm b. separates the nucleus from the cytoplasm c. separates the cell interior from the environment d. both a and c
The cytoplasm of a certain cell is composed of a solution that is 98% water, 2% solutes. Consider the solution shown in the beaker in this picture: FOOE OOS Foor solution. [Select] Cytoplasm is 98% water, 2% solutes. The solution in the beaker would be considered when compared to [Select] The plasma membrane is impermeable to solutes. Beaker solution is 98% water, 2% solutes the cell. We would expect that the cell would [Select] if it was placed in the would account for whatever changes might occur to the volume of the cytoplasm of the cell when it is placed in the solution.
As part of their function, membrane-bound organelles, such as mitochondria and the en- doplasmic reticulum, must move substances across their membranes. Which of the following statements best describes a feature shared by mitochondria and the endoplasmic reticulum that increases the efficiency of their functions? A B с D double membranes, in which one membrane encloses the other rigid and nonfluid membranes membranes composed of carbohydrates highly folded membranes
Which of the following molecules would you expect to diffuse through the lipid bilayer of a plasma membrane most slowly, if at all? CO2 O2 CH4-a nonpolar compound A charged molecule Water
Secretory vesicles fuse with the cell membrane to release their contents to the outside of the cell. In this process, the membrane of the secretory vesicle becomes part of the cell membrane because small pieces of the membrane are continually added to the cell membrane, one would expect the cell membrane to become larger and larger as secretion continues. The cell membrane stays the same size, however. Explain how this happens.
Which of the following molecules would you expect to diffuse through the lipid bilayer of a plasma membrane most rapidly? Na+ An amino acid Starch Glucose O2
Certain cells in your pancreas make digestive enzymes that are secreted into ducts and carried to your small intestine. If you looked at these pancreatic cells with electron microscopy, you would expect to see numerous cilia on the cell surfaces. multiple nuclei per cell. large amounts of rough ER. few ribosomes but numerous vacuoles. large numbers of primary lysosomes.
When a sea horse sees a predator, its nervous system kicks into high gear. A charge reversal wave will travel the length of the nerve cell. When the impulse reaches the end of one nerve cell it must travel across the synapse to the next cell. Neurotransmitters exit one cell and enter another via a method of active transport called, exocytosis. Which structure is responsible for transmitting signals from one nerve cell to the next via this process? Ribosome O Cell membrane Nucleus O Endoplasmic reticulum
Which of the followings is not true about the function of the Tight Junctions? (LO- K8) They hold the cells together They act as a barrier They help maintain cell polarity They prevent lateral diffusion of proteins, ions, molecules They play an important role in maintaining the blood brain barrier They connect the adjacent cells intercellularly to the intermediate cytoskeletal filaments
Which of the following is true regarding the permeability of the cytoplasmic membrane? Nothing can diffuse across the membrane All molecules can freely diffuse across it Only non-polar molecules can diffuse across the membrane It is generally impermeable to ions, polar molecules
Which of the following is CORRECT regarding the endomembrane system of the cell? Group of answer choices The organelles comprising the system are all lined by a continuous It regulates protein traffic from one organelle to another. Lysosomes are products of the system and not a component organelle. The Golgi apparatus accounts for more than half of the total membrane in many cells.