Question 8 Listen In the following questions arrows are used to represent primers. The arrow head is the 3' end of the primer and the other end of the arrow represents the 5' end. Which of the following represents the orientation of primers in a PCR reaction. (The DNA to be amplified is between the arrows) a) b) ↑ c) ↑ ↑

Approach to solving the question:Direct approach Detailed explanation:The primer attachment occur in…

Answered: Question 8 Listen In the following questions arrows are used to represent primers. The arrow head is the 3' end of the primer and the other end of the arrow…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN: 9780134580999

Author: Elaine N. Marieb, Katja N. Hoehn

Publisher: PEARSON

See similar textbooks

Related questions

Question

100%

Genetics Q8

Question 8
Listen
In the following questions arrows are used to represent primers. The arrow head is
the 3' end of the primer and the other end of the arrow represents the 5' end. Which
of the following represents the orientation of primers in a PCR reaction. (The DNA to
be amplified is between the arrows)
a)
b)
↑
c)
↑
↑

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

See solution Check out a sample Q&A here

Step by stepSolved in 2 steps with 1 images

See solution

Check out a sample Q&A here

Knowledge Booster

Similar questions

QUESTION 23 Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR QUESTION 24 Mutagens are useful in biotechnology research for Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answe
QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…
Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the Zipgrade answer sheet. Primase DNA Polymerase Ligase Helicase Topoisomerase/gyrase а. b. с. d. е. 6. This enzyme starts the replication process with a small strand of RNA that is later replaced. 7. This enzyme removes primer and starts adding DNA. 8. This enzyme joins Okazaki Fragments. 9. This enzyme unwinds the original strands of DNA so they can act as templates. 10. This enzyme prevents supercoiling .
QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram: Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question. Also, please don't forget to answer question 61 1. Leading strand= 2. Lagging strand= 3. A single Okazaki fragment= 4. 3' end of fragment labeled "H"= 5. Replication fork= H E G 6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and leading strand)?=
QUESTION 1 In this gel, PCR is performed using primers outside of the repeat area anf the product is then run on a gel. Which of these alleles would be the lowest band and which would be the highest band when run on a gel (remember how electrophoresis works!!) ALLELES #1 -CACACACACACACACACACACACACACACA -CACACACACACACACACACACACACACACACACA # 2 # 3 -CACACACACACACACACACACACACACACACACACA- GENOTYPES 1 2 3 4 5 6. O 1 is lowest band and 3 is the highest band O 3 is lowest band and 1 is the highest band O 1 is the lowest band and 2 is the highest band
QUESTION 22 During the search for the Cystic Fibrosis (CF) gene the investigators used various criteria to conclude that they had arrived at a segment that represented a gene. Which of the properties below was among the criteria used by the investigators? O A. the presence of sequence palindromes O B. gene-specific restriction maps O C. interspecies sequence conservation O D. polyadenylation signals O E. the presence of AT-rich islands QUESTION 23 A feature common to activation of the myc oncogene by both the Avian Leukosis virus and the chromosomal 8:14 translocation is: O A. loss of the 1st myc exon (E1); initiation of transcription from a start site within the myc intron O B. Initiation of transcription from a strong promoter upstream from the first myc exon (E1) O C.A fusion transcript between an active upstream gene and the three myc exons O D.A DNA deletion that eliminates the transcriptional termination signal from an active upstream gene. O E. Recombination between the myc…
QUESTION 2 The SARS-COV-2 pandemic resulted in the desire to design ELISA assays to either detect antibodies against SARS-CoV-2 protein (previous infection), or detect viral protein (current infection). You plan to express the mutant spike protein variant using the plasmid pictured below as your template. Here's the sequence you want to put in its place: https://www.ncbi.nlm.nih.gov/nuccore/AY429073.1?report=fasta, this is the DNA sequence you're going to buy as a gene block! But you need to add a couple things to it first so it'll get into the plasmid. To do so, you're going to need to remove the current insert (represented by the yellow arrow beginning at position 833-4867). Question: What restriction sites are you going to add at the ends of the gene? Answer can be in nucleotides or the enzyme name. For the first blank fill in the site name/sequence you'd add at the beginning of the gene (5' / C-terminus end) and for the second blank fill in the sequence/site name you'd add at the…
QUESTION 1 The table below shows the results from looking at the diagnostic accuracy of a new rapid antigen test for COVID-19 in 100000 patients, compared to the reference standard RT-PCR test. The rows of the table represent the test result and the columns the true disease status (as confirmed by RT-PCR). COVID-19 Positive COVID-19 Negative Antigen Test Positive Antigen Test Negative 424 795 8216 90565 Calculate the SENSITIVITY of this new rapid antigen test as percentage with 3 decimal places. (Assume that the RT-PCR reference has a 100% Sensitivity and 100% Specificity.)
QUESTION 3 You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1X buffer in a total volume of 80 ul. Complete the table below: Solution Stock solution Working solution Volume needed restriction digestion buffer 10X 1X DNA 200 ng/ul 1.5 με enzymes 1 unit/ul 1 unit Water Total 80 μL
Question 11 1. An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1.0, 3.0 and 5.0 kb are seen. 2. When the same plasmid is cut with both the EcoRI and BamHl restriction enzymes (a double digest), bands of 1.0, 1.5, 3.0, and 3.5 kb are seen. From these results, it can be concluded tha v[ Select ] cuts within the BamHI [ Select ] v kb [Select EcoRI

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education