Question 8 Electrophoresis in agarose gel A The DNA will migrate to the negative elec- trode due to the presence of phosphate groups. B For a given DNA molecule, the higher the percentage in G/C pairs, the less the DNA will migrate. C The migration speed depends on the agarose percentage. D The migration of an undigested, circular plasmid DNA will depend solely on its number of base pairs. E If the migration buffer is at physiological pH (7.4), the DNA will not migrate.

Question 8 Electrophoresis in agarose gel A The DNA will migrate to the negative elec- trode due to the presence of phosphate groups. B For a given DNA molecule, the higher the percentage in G/C pairs, the less the DNA will migrate. C The migration speed depends on the agarose percentage. D The migration of an undigested, circular plasmid DNA will depend solely on its number of base pairs. E If the migration buffer is at physiological pH (7.4), the DNA will not migrate.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

QUESTION 3 You are provided with plasmid DNA at 200ng/uL, 10X restriction digestion buffer, restriction enzymes (1 unit/ul) and water. You want to digest 1.5 ug of plasmid DNA with 1 unit (U) of enzyme in 1X buffer in a total volume of 80 ul. Complete the table below: Solution Stock solution Working solution Volume needed restriction digestion buffer 10X 1X DNA 200 ng/ul 1.5 με enzymes 1 unit/ul 1 unit Water Total 80 μL
Question 17 Nucleotides contain all of the following except O a 5-carbon sugar. O histones. O a phosphate group. O a nitrogen base. otx PRINECOMA3_..pptx MacBook Air F2 F3 F4 F5 F6 F7 F8 @ 2$ & * 3 8. W E T Y S D H J V M. * 00 B
Question 8 If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG
QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3'? a) Assuming that the four bases are equally likely to be found in a DNA molecule. O (1/4)6 O (1/4)4 O (1/6)4 O 1 in 6 O (1/6)6
Question 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What is a possible resulting sequence of the complementary strand after the reaction is finished assuming adequate amounts of all normal nucleotides and some ddGTP? 5' 5' O GATGC O TGCG O ATGC AGATGC с POLYMERASE 3" T G C '5' 3º in
Question 25 If one DNA segment has the following base composition, 5-CAGTTAGTCA-3', which of the following sequences is complementary? A 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5' 3-TGACTAAСTG-5 D 5-TGACTAACTG-3'
Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and hybridize it to the mRNA encoding Tau from the cytoplasm of the same cells. Describe what you see when you look at the molecules under the electron microscope. A. A double-stranded DNA-RNA hybrid with complete overlap of all the sequences. B. A partially double stranded DNA-RNA hybrid molecule containing regions of DNA-RNA overlap representing the mRNA exons, loops where there are introns and tails at the 5' and 3' ends. C. A partially double-stranded molecule containing regions of DNA-RNA overlap representing the mRNA introns, loops where there are introns and tails at the 5' and 3' ends. D. Regions of DNA-RNA overlap representing the mRNA exons and loops where there are introns with no tails at the 5' or 3' ends. E. Two distinct molecules with no overlapping regions. Multiple Choice
QUESTION 21 Choose each of the characteristic(s) of all RNA polymerases from the list below. A. elongation adds new ribonucleotides to the 3-OH B. requires a primer to initiate synthesis C. have 3' to 5' exonuclease activity D. adds nucleotides based on sequence complementarity to a template E. have 5' to 3' polymerase activity O F. elongation adds new ribonucleotides to the 2'-OH G. have 3' to 5' polymerase activity
Question 59 FLAG QUESTION Answers A-E When comparing the mode of action of benzopyrene with ethidium bromide, one sees that both have a flat and hydrophobic structure. Both will enter the double helix of DNA and will be retained, at least in part, by the hydrophobic stacking of the bases. But the most important difference is: A Only Ethidium will color the DNA B Benzopyrene forms a covalent bond with DNA C Only Benzopyrene will form tumors D Ethidium makes DNA resist UV light) E There is a specific enzyme that removes Ethidium from DNA ● 0 O *** 0
Question 8 The cloning a eukaryotic gene in a bacterial plasmid does not include extension gene inserted into a cloning vector such as a plasmid The vector is obtained by bacterial cells. O Host cells grown in culture to form a clone of cells containing the "cloned gene of interest" O formation of a recombinant DNA
Question 15 When you successfully inserted a gene fragment into the Hindill site and transform bacteria with the plasmid. How can you tell which transformants have the insert? ... The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the enzyme ß-galactosidase, the product of which will turn bacterial colonies blue when grown in the presence of X-gal; the Amp gene confers ampicillin resistance. EcoRI Bam HI BamHI HindIII PSU922 BamHI Bam HI EcoRI ori C (A) The bacteria will not be able to grow in the presence of ampicillin, and they will be blue. B) The bacteria will not be able to grow in the presence of ampicillin, and they will be white. (C) The bacteria will be able to grow in the presence of ampicillin, and they will be white. (D) The bacteria will be able to grow in the presence of ampicillin, and they will be blue. AmpR F-gat