Question 4 A series of 6-arylmethylidene penicillin-based sulfone inhibitors (1) were developed as a combination treatment to restore the efficacy of a series of B-lactam antibiotics in bacterial species that carry carbapenem- hydrolyzing B-lactamases. The proposed mechanism of inhibition involves the formation of the enzyme-molecule adduct 2. Please provide an arrow-pushing mechanism using strictly serine as a nucleophile. [Note: Remember that water is present as well] beta-lactamase SO. Me `Me OR "Me Me OR Co,H H. co,H Ser penicillin 1 2

Q: summary paragraph describing lysozyme and what it does

A: Lysozyme is a important enzyme perform verious important role in body. Lysosome helps in the…

Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…

A:

Q: Write down the amino acid sequence of the tripeptide shown below. CH3 H H₂N NH -NH,

A: The above given figure is of a tripeptide. Since we know that an amino acid sequence begins with…

Q: Excess vitamin K in natural forms is not toxic, toxicity occurs with synthetic vitamin K called…

A: The vitamins are the essential nutrients which we get mostly from the food .

Q: what are the 7 indicator microorganisms that must not be exist in pharmaceutical products ? how we…

A: Microorganisms aid in the creation of various foods, the manufacture of medications, the…

Q: A drug–protein complex can be injected into an animalto form specific ___________ for that drug.

A: According to the question, we have to find out a drug-protein complex that can be injected into an…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: A gene is made up of (choose one: RNA, protein, DNA, carbohydrate).

A: A gene is the functional unit of inheritance. These are made up of DNA.  These genes contains…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: What is mature mRNA and how it is made. What kind of enzymes are involved in making of mature mRNA?

A:

Q: A ALEKS - Julianna Graham - Lex ← -> C +…

A: The complete mutated DNA sequences for both types of mutations (silent and non-silent) from the…

Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…

A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…

Q: Bilirubin is converted from unconjugated into conjugated before entering the liver. False O True

A: Bilubirin is a pigment in bile and is formed through hemolysis, which is the breakdown of blood…

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…

Q: Name the disease occur due to defective Nonhomologous End Joining Repair.

A: There are four phases of cell cycle G1, S, G2 and M. Most of the DNA repair occur in G1 phase of…

Q: Isoform of hactate ole hy droganare (LDHJ prでsent in heart.

A: Isoenzymes are different from of enzyme that catalyses same biochemical reactions.

Q: Multiplexing agglutination

A: Multiplex assays, a type of immunoassay which constitutes of  tests in which magnetic beads are used…

Q: A protein 'standard curve' is a graph showing how absorbance changes with the amount of protein True…

A: Proteins are biomolecules which is made up of aminoacids connected via peptide bonds. These are of…

Q: one paragraph contains the definition of anemia, causes, signs and symptoms, and healthy diet for it

A: Anemia It is sometimes associated with increased risk of mortality and morbidity.  Iron deficiency…

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: A nickname for InTouch Health’s RP-6 for Remote Presence.

A: Remote Presence robot, RP-6, developed by iRobot in association with InTouch Health Inc., located in…

Q: B) Upon further testing, it is discovered that Individual I-1 has a mild case of the disease. Please…

A: The X-linked recessive disorder is a genetic condition in which mutations in genes are present on…

Q: Zイ PS 22

A: Prophase

Q: Scientists suggest a major evolutionary shift may have occurred when some human populations in east…

A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes."…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Genetic engineers would like to insert the gene for producing thrombin, a protein which facilitates…

A: Plasmids are circular molecules of DNA. Most plasmids inhabit within bacteria, and around 50% of…

Q: Mechanization of transportation has allowed mass movement of humans all around the globe in the past…

A: Globalization is a complex and multi-faceted set of processes that has a wide range of effects on…

Q: The nucleotide is adenine adenosine adenosine monophosphate cytidine prion

A: A nucleotide is the basic building block of nucleic acids like RNA and DNA. The nucleic acids act as…

Q: Please answer parts a, b, and c and show work please

A: The objective of the question is to calculate the dosage of medication in different units of…

Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .

A: In cells, different parts have specific jobs in making and controlling proteins. One important part…

Q: vidual plants with the branched diagram and corresponding correspor ding

A: A genotype is an individual's collection of genes. A phenotype is an individual's observable traits,…

Q: Discuss about serines/threonines

A: An enzyme that catalyzes the phosphorylation reaction is called “kinase”. This enzyme transfers a…

Q: How lactulose works Or write the mode of action of lactulose?  Please answer at your own words.

A: Lactulose plays a key role in managing patients with Hepatic encephalopathy wherein Ammonia levels…

Q: 1) Genetically Modified Organisms (GMOS) What are GMOS? Describe fully Identify a plant that has…

A: Step 1 Hello. Since you have posted a question with multiple sub-parts, we will solve the first…

Q: ACTIVITY 2. COVID-19 RT-PCR TEST Directions: This is a manual simulation of COVID-19 RT-PCR test.…

A: In order to identify the DNA sequence is belonging to SARS CoV-2, the final protein products…

Q: A280/ A260 of 1.3. Estimate the pro 1. A solution of a purified protein yielded 0ontration of the…

A: Standard curves of purified reference proteins are used to determine the concentration of the…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Choose the correct statement/s regarding gene targeting in embryonic stem cells: gene targeting is…

A: Gene targeting is a replacement strategy based on the homologous recombination of the desired genes.…

Q: What does "indel" stand for? Group of answer choices internal/deleterious insertion/deletion…

A: Indel is a term related to molecular biology and is responsible for causing small variation in the…

Q: TRANSCRIPTION PROCESS: 1. Describe the differences in the transcription and translation processes as…

A: 1. Transcription is the process in which a gene's DNA sequence is transcribed to make an RNA…

Q: 15 11

A: Spinal cord is a long, tubular structure of the nervous system. It arises from brainstem and extends…

Q: what is protein sorting ?

A: Protein sorting is the mechanism by which the proteins are transported to their appropriate location…

Q: _____________ are short nucleic acid segments containing 50 nucleotides or less.

A: Primer Oligonucleotides are nucleic acid segments containing 20-30 nucleotides

Q: Name the five common glycogen storage diseases and explain von Gierke's disease.

A: Glycogen storage disease is a group of disorder which occur due to improper storage and utilization…