Question 2 Which of the following are factors that can influence mutation rates? Mark all that apply. the genetic code Onucleotide repeats Ophenotype None of these influence mutation rates gene size
Q: 4. In the table below, describe the roles of the extraembryonic membranes. Amnion Allantois Chorion…
A: Four membranes known as extraembryonic membranes aid in the growth of an animal's embryo. These…
Q: 14. What is required to convert Ribulose bisphosphate to 3-phosphoglycerate (PGA)? a. b. the…
A: The answer is--- d. The addition of CO2 and water is required to convert ribulose bisphosphate to…
Q: True or false Edward Jenner first proposed protective vaccine against plague in the 18th century.…
A: Plague is a bacterial infection caused by the bacterium Yersinia pestis. It is primarily transmitted…
Q: What type of bond occurs when electrons are shared between atoms? hydrogen bonds covalent bonds…
A: There are different types of biological interactions occur in the molecules.The bonds present in the…
Q: 11. What is homeostasis? a. b. C. d. a. b. the process in which internal conditions are kept within…
A: The science of humankind through the effects and interactions of many different academic…
Q: 2. The Theory of Endosymbiosis states that: Plant cells are endosymbionts a. b. C. d. The…
A: Endosymbiosis is the theory of evolution of eukaryotes. Eukaryotes have a well partitioned cellular…
Q: What_t_-SNARE protein changes from a _trans_ to a _cis_ state to facilitate the transformation of a…
A: The process of neurotransmitter release from a neuron involves the fusion of a vesicle containing…
Q: In which of the following types of large-scale mutations would there be a loss of genetic…
A: ANSWER) Translocation- It is described as the change in location of chromosome. Some part of a…
Q: Write the 3 short term effects and 3 long term effects in given classification of substance
A: Drugs are the substances which have physical or physiological effects on the body.Drugs are used to…
Q: 3. The figure below depicts a protein folding into its final shape. If this was a cytoplasmic…
A: Proteins are sequence of amino acids that fold in their own conformation to perform it's function.…
Q: In your own words , Explain the structure of the nasal cavity, trachea and alveoli. Linking their…
A: Introduction:- The primary function of the respiratory system's major organs are to eliminate carbon…
Q: true or false bb.Neurons can communicate using electric impulses in the axon and neurotransmitters…
A: Nervous system is also the command centre of our body. It transmit electric signal from brain to…
Q: How is it possible for aphids to feed only on the carbohydrate-rich but nutrient-poor sap of phloem…
A: Microbiology: The science of micro creatures' biology includes viruses, bacteria, algae, fungus,…
Q: Which of the following statements is true about NHEJ (Non-Homologous End Joining) repair? a. This is…
A: Non-homologous end joining(NHEJ) is basically a repair pathway.It mainly repairs double-strand…
Q: Which of the following statements is consistent with the abundance-center hypothesis? (Choose all…
A: Abundance- centre hypothesis This hypothesis explains genetic diversity which is based on the size…
Q: la. gisismo o 1b. A ----- DICHOTOMOUS KEY FOR SHAPES Shape has distinct corners Shape does not have…
A: A phylogenetic tree represents the evolutionary relationships between different organisms. In the…
Q: 23: Vmax, the maximum velocity, of an enzyme-catalyzed reaction is: A) The rate observed when all…
A: In living beings there are a complex nitrogen-containing molecules are called enzymes. These…
Q: s false regarding the role of mediator complex in eukaryotic transcription
A: a. Mediator complex interacts with RNA pol II
Q: When we measure species density. If you apply random sampling and systematic sampling to a site…
A: When we measure species density, we always choose the random sampling method as sampling method.…
Q: What blood types are compatible with B blood
A: Introduction: The four main blood types (groups) are A, B, AB, and O. The genes we acquire from our…
Q: Define the types of neurons, and give the functions and example.
A: Neurons These are the basic units of our nervous system that is involved in transmitting information…
Q: 4. Who covers the cost of genetic testing? Is this approved by most insurance carriers? If the test…
A: Genetic testing is a type of medical test that examines an individual's DNA, the genetic material…
Q: How do you convert 50 umol/ml*sec to M/sec ?
A: Molarity (M) is a term given to quantify a substance in terms of mole/l in its standard form. But,…
Q: When a pure breeding yellow skin chicken and a pure breeding white skin rooster mate, the resulting…
A: explanation each option- A. Semidominace =In semi-dominance, there is a blending of the two alleles…
Q: What does cortisol do in the acute response to stress? O Prepares the body for fighting an…
A: Introduction: The body responds to cortisol in a variety of ways, including by activating the…
Q: Give 3 short term & long term effects of alcohol And give 3 short term & long term effects of…
A: Alcohol has both immediate and long-term consequences that are substantial. Depending on a number of…
Q: The primary function of 5' & 3' end mRNA modification is: a. To ensure that phosphorylation of the…
A: The mRNA synthesized by transcription undergoes modifications before they bind with ribosomes for…
Q: one potential treatment for addiction is to inhibit the expression of the gene that codes for the…
A: Addiction is a complex condition that is characterized by compulsive drug-seeking behavior and drug…
Q: Is whole-genome sequencing for an individual beneficial? Why or why not?
A: The process of whole-genome sequencing (WGS) allows for a thorough examination of the complete…
Q: Which cells myelinate the axons of central and peripheral nervous system neurons? Why is myelination…
A: Myelination is a process by which the axons of nerve cells are covered by a fatty insulating layer…
Q: r boss has invented three supplements that have been proven to impact metabolism, and she is trying…
A: Glucose is a Carbohydrate and it provides energy by the process of glycolysis or by aerobic…
Q: 1. As DNA engages in semi-conservative replication, explain what the following enzymes roles are in…
A: The process of replication follows a semi-conservative model and approach. In this process, DNA…
Q: What is the purpose of an emulsifying agent? List atleast 5 examples used in pharmaceutical…
A: Emulsifying agent An emulsifying agent also called emulsifier refers to a surface-active ingredient…
Q: What is the required volume of 5X PrimeSTAR GXL PCR Buffer (in μL) in the 2.25x Master Mix
A: Given information Concentration of PrimeSTAR - 5x. Let this be denoted as C1. Concentration of…
Q: Viruses are not typically considered living organisms because they contain no biological molecules…
A: A virus is a small infectious agent that consists of genetic material (DNA or RNA) surrounded by a…
Q: 2. What is the role of the Promotor Region and the highly characterized promoter sequence, the TATA…
A: Transcription is process of converting DNA to mRNA.
Q: Imagine you are a student in Alfred Hershey and Martha Chase's lab in the late 1940s. You are given…
A: Hershey and Chase experiment was just like a milestone in the history of genetics.By this experiment…
Q: 2. A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many…
A: Histones are highly basic proteins that provide support and shape for a chromosome. Core histones…
Q: BELL JAR EXPERIMENT In the early 1770s, Joseph Priestley conducted a series of experiments that…
A: Introduction Plants produces their own food (carbohydrate) in the presence of sunlight, carbon…
Q: What about the references?
A: If we see around us there so much there to explore and learn. Science allows us to understand things…
Q: What characteristics does a lizard have to adapt to desert wind and dust storms? For example what…
A: Reptiles and amphibians can live in desert environments without suffering from extremities of…
Q: Explain monohybrid cross with a suitable example
A: Monohybrid cross is a cross which deals with only one character. This character is represented by…
Q: CASE: Overlapping Relationships During a routine physical examination at your rural practice, one of…
A: As we as a SME, allowed to do only limited questions at a time. So I'll be answering Frist two…
Q: 1. Nephrons within the kidney are responsible for filtering blood to maintain homeostasis within the…
A: 1. Starting the labeling from the right side; The 1st box (uppermost) is pointing towards Proximal…
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) the origin of…
A: DNA is a double stranded molecule. DNA replication is Semi conservative. This means that each DNA…
Q: Which of the following statements presents the strongest evidence that all life on Earth has a…
A: According to a recent research, all life on Earth descended from a single-celled creature that…
Q: 98. Which of these could cause hemolytic anemia? A. Genetics B. Snake venom C. Chemotherapy drugs D.…
A: Anemia caused by excessive hemolysis happens when there are not enough RBCs in the body. Hemolysis…
Q: During which month is CO2 level the highest ? the lowest? This question has two parts and requires…
A: The most significant greenhouse gas on Earth is carbon dioxide, which both absorbs as well as…
Q: 1. Which hormone does the adrenal medulla secrete in response to stress? mineralocorticoids a. b. C.…
A: 1.Hormones are the low molecular weight, chemical substances which are produced in very small amount…
Q: Which is NOT a common type of HAI? Question 11 options: a) Covid-19 b) pneumonia (lower…
A: B. Pneumonia
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutationTrinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.Plssssss helppppp Explain why there is a phenotypic change in insertion and deletion point mutations?
- When considering the mutational options for a nucleotide such as thymine, there is a single transition and two transversion type mutations that are possible, which is why we observe transversions to occur more frequently in nature when genomes are examined. O True O FalseThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingThe table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Met - Leu - Arg - Ile - ... Type of mutation Wild type Met - Leu - Arg - Met - ... Met - Leu - [STOP] Mutant 1 transition Mutant 2 transversion Mutant 3 Met - Phe - Arg - Ile - ... transition Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table. Met Leu Arg Ile Answer Bank CỦA AUA CGU CGA AUG AUC AGA UUG CÚC
- Select all the possible mutation types for the following observed phenotype resulting from a mutation in a coding gene: A protein is made but is shorter with an abnormal shape, and no enzymatic activity. a non conservative missense mutation O an in-frame indel of 1 amino acid Oa frameshift a nonsense mutation Oa mutation in one splice siteMutation rates vary for genes. All of the following are factors that influence the mutation rate of a gene EXCEPT: O repetitive nucleotide sequences size of the gene spontaneous chemical changes: C/G base pairs are more likely to mutate than A/T pairs O all of these factors influence gene mutation rates exposure to environmental triggers5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
- A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion. Seven E. coli mutants were isolated. The activity ofthe enzyme β-galactosidase produced by cells containing each mutation alone or in combination with othermutations was measured when the cells were grown inmedium with different carbon sources.Lactose +Glycerol Lactose GlucoseWild type 0 1000 10Mutant 1 0 10 10Mutant 2 0 10 10Mutant 3 0 0 0Mutant 4 0 0 0Mutant 5 1000 1000 10Mutant 6 1000 1000 10Mutant 7 0 1000 10F′ lac from mutant 0 1000 101/ mutant 3F′ lac from mutant 0 10 102/ mutant 3Mutants 3 + 7 0 1000 10Mutants 4 + 7 0 0 0Mutants 5 + 7 0 1000 10Mutants 6 + 7 1000 1000 10Assume that each of the seven mutations is one andonly one of the genetic lesions in the following list.Identify the type of alteration each mutation represents.a. superrepressorb. operator deletionc. nonsense (amber) suppressor tRNA gene (assumethat the suppressor tRNA is 100% efficient in suppressing amber mutations)d. defective CRP–cAMP binding sitee. nonsense (amber) mutation in the β-galactosidase genef.…G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected