QUESTION 1 Picture 1 Pic. 1: Name one genus/species from the fungi we studied that might be growing on this sample. O a. Candida albicans b. Aspergillus c. Penicillium Od. Claviceps QUESTION 2 Pic.1: What is the fruiting structure of this microbe? a. Conidiophore O b. Sporangiophore c. Blastoconidia Od.Arthrospores QUESTION 3 Pic. 1: What type of infection could it cause? O a. Systemic b. Subcutaneous Oc. Cutaneous Od. Opportunistic

Q: Which group of bacteria contains the gram-positive, anaerobic bacterium that causes botulism? (a)…

A: Introduction :- Bacteria having thick cell walls are known as Gram-positive bacteria. These…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Which are true regarding tick-borne bacterial diseases? Select all that apply. - One example is the…

A: Tick borne diseases, that affect the human and other animals, are caused by pathogens transmitted…

Q: What is the most probable cause of the patient’s elevated urea nitrogen?

A: The patient has the conditions of chronic renal failure, diabetes, heart failure, anaemia, HTN.  The…

Q: Which of the following statements regarding nucleotides is false? A) Nucleotides contain sugar…

A: The nucleotide is the sub unit of nucleic acid. DNA and RNA are the examples of nucleic acid. The…

Q: To determine: The reason for plant death if its stomata is closed or opened all the time.

A: Introduction Plant cell death is the end of a plant cell's life activities due to an intracellular…

Q: Stretching a skeletal muscle can depolarize sensory afferents that project into the spinal cord and…

A: Muscles  Muscles are the soft tissue with ability to contract hence help in movement of body parts.

Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…

A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…

Q: Why does the plasma membrane of a cell present a barrier to the movement of electrolytes through it?…

A: Introduction - The plasma membrane is a thin lipid bilayer that surrounds and protects the cell's…

Q: What is structural variation of genomes? Describe the mechanisms that create structural variants,…

A: Structural variations are referred to variation or difference in the structure of chromosome of…

Q: Q4

A: The physiological lack which the sperm fulfills for an ovum is the lack of spindle set for…

Q: the yeast isolates are Cryptococcus neoformans and Candida albicans. what test will you do yo…

A: Fungus Fungus is a saprophytic, spore-forming organism that belongs to the domain Eukaryota. These…

Q: What is the ecological significance of the diatoms? The brown algae?

A: Brown algae are algae that belong to the class Phaeophyceae and due to their brown color, they are…

Q: Describe a case of schizophrenia you have seen.  Why do you think the person has schizophrenia?

A: Schizophrenia is a chronic and severe mental disorder characterized by distortions in thinking,…

Q: 6 If exposure to a more acidic pH caused a decline in some sea urchin populations, how might this…

A: Ocean acidification is sometimes referred to as "climate change's equally wicked twin," and with…

Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…

A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: Match each term on the left with the best example on the right E photosystems NADP+ E G3P molecule…

A: Photosynthesis is the process of synthesizing the glucose from the carbon dioxide water and…

Q: In sulfur photosynthetic bacteria what is the molecule that donates hydrogen for photosynthesis?

A: Introduction - Sulfur-oxidizing bacteria are prevalent. Thiobacillus thiooxidans is a…

Q: salient features of guidelines on the disposition of confiscated wildlife species in the Philippines

A: Wildlife species are the animals that are undomesticated and live in an area where they arrive…

Q: Which among the following statements is NOT an important function of skeletal system? OA. calcium…

A: Skeletal system is the body's main central framework. It consists of bones, connective tissues such…

Q: Why do you think most Americans do not take in enough calcium and/pr vitamin D in their diet? Should…

A: INTRODUCTION Vitamins and minerals are considered essential nutrients because they play many roles…

Q: Photosynthesis is the most important producer of molecular oxygen (02) on our planet. From which…

A: To explain: To explain about photosynthesis, the molecules involved, and the destination of the…

Q: Describe the timeline of an acute infection, particularly naming which cells are the first to arrive…

A: Acute infections are infections that are caused suddenly by any condition or by pathogens such as…

Q: How do antibodies work to eradicate pathogens?

A: Antibodies can be referred to as specialized Y-shaped proteins which have the ability to degrade the…

Q: Which of the following statements regarding RNA is false? O A) RNA is a nucleic acid. O B) One RNA…

A: RNA stands for Ribonucleic acid. It is one of the genetic material present in the cell. The whole…

Q: Height among red stalk plants is divided into tall, medium and short. From tests, scientists know it…

A: An allele is an alternative copy of a gene. When an organism is diploid, it can contain two alleles…

Q: extinction

A:

Q: After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome, the resulting…

A: Once mRNAs enter the cytoplasm they are translated stored for later translation or degraded. mRNAs…

Q: Several proteins involved in DNA repair are used in multiple pathways. Which one of the following is…

A:

Q: Which of the following is not part of a carpel? O anther O style O stigma O ovary

A: The central whorl of a flower is made up of leaflike, seed-bearing components. The pistil is made up…

Q: Explain, in detail, how tyrosine kinase proteins are involved in one signal transduction pathway of…

A: The signal transduction pathways in cell occurs via three types - G protein couple receptors,…

Q: What is a transitional fossil? Transitional fossils were poorly adapted to their environments. O…

A: Introduction - Any preserved remains, impression, or trace of any once-living thing from a previous…

Q: How will you be able to distinguish between those organisms that are able and those that are not…

A: Answer

Q: 5. How might exposure to a more acidic pH affect the growth, development and reproduction of sea…

A: Sea urchins come under the category of keystone species, indicating their abundance has a direct…

Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.

A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…

Q: This pedigree traces the inheritance of a rare disease in humans. a. Based on this pedigree, is the…

A: Answer is given below.

Q: Root hairs increase the surface area of the root O increase water absorption increase nutrient…

A: Water and mineral nutrients move from the soil to the upper parts of the plants through the xylem.…

Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.

A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…

Q: Which are with Helper T-cells

A: Helper T-cells is a type of immune cell that stimulates killer T cells, macrophages, and B cells to…

Q: 4. Write short notes on Ribosome.

A: Introduction - The site of protein synthesis in the cell is the ribosome, which is an intercellular…

Q: Using the following list, describe the proper sequence for the events of animal development: 1.…

A: Animal development is occurs in sequential manner.

Q: in the middle to late stages of the stance phase of the gait cycle, the muscles of the lower…

A: Gait cycle:  The gait cycle is a cyclic movement pattern that happens while walking. A gait cycle…

Q: Question 44 1 pts Reactants capable of interacting to form products in a chemical reaction must…

A: Activation energy is defined as the minimum amount of extra energy required by a reacting molecule…

Q: How is it possible for some molecules to be atequilibrium across a biological membrane and yet not…

A: Introduction :- Biological membranes are made up of two sheets of lipid molecules (known as a…

Q: What are the divisions of white light according to the electromagnetic spectrum? Which are the two…

A: The white light is made up of seven colors spread between the wavelength of 400 nm to 780 nm. This…

Q: Below is a Figure of an Onion Root Tip, determine which of the encircled is/are meristematic?

A: Among the encircled regions the region 1 is representing the root apical meristem.

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: Ô https://blackboard.grandview.e.. A 自 D Question Completion Status: 2 points Save Answer QUESTION 5…

A: Fatty acids, that can not be synthesized by our body but they are essential for our good health.…