Which among the following statements is NOT an important function of skeletal system? OA. calcium homeostasis. O B. body framework OC. conduction of nerve signals. O D. support and locomotion.

Q: he arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…

A: The heart vessels will not be having any blood supply in them when the pressure inside them will be…

Q: Polymerase movement RNA POLYMERASE -Nucleotide being added to the vijend of the RNA RNA NTPS RNA-DNA…

A: i) - 5'- ii)- Template strand/Sense Stand iii)- Region of DNA unwinding  iv)- Codon strand/Antisense…

Q: You've been assigned with isolating a certain species of bacteria from a mixed culture in order to…

A: Introduction  Microbial isolation is a technique for growing microorganisms outside of their natural…

Q: a.What would happen if IKKbeta did not phosphorylate IkappaB? b.Why is it so hard to make cytokine…

A: IKKalpha, IKKbeta, and IKKgamma are the three sub units of IkappaB kinase. Out of these Ikk alpha…

Q: What is the full regulatory pathway of glycogen synthase and glycogen phosphorylase by insulin and…

A: Insulin is a protein hormone which is secreted by the beta cells of the islets of Langerhans in…

Q: What is structural variation of genomes? Describe the mechanisms that create structural variants,…

A: Structural variations are referred to variation or difference in the structure of chromosome of…

Q: You work for a large biotechnology company that is studying viruses, vaccines, and small molecule…

A: There are few important points that should be kept in mind : Viruses are simple ,noncellular and…

Q: O autosomal recessive OX-linked dominant OX-linked recessive Oautosomal dominant O mitochondrial O…

A: This is the Pedigree shown in the figure which follows are of the inheritance pattern. If the…

Q: The answer is wrong, can you please check which is the correct answer from the multiple choice.…

A: The question provided was confusing as it didn't mention what has to be answered. Answer will be…

Q: During a course of standard radiation therapy 2 weeks after the start, there was a break of…

A: Introduction Radiation therapy:- It is a type of cancer treatment that uses beams of intense energy…

Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…

A: There are number of processes necessary for the continuation of generation , growth and…

Q: Puseletso is an 18 year old girl,with a BMI of 17.5 kg. Give advise on how she could improve her…

A: Body mass index is abbreviated as BMI. It refers to the ratio of a person's height to their weight.…

Q: Why should people care about the article "Stopping pandemics before they start: Lessons learned from…

A: SAR-COV-2 virus is a member of a large family of coronavirus. It affects the respiratory system of…

Q: 12. The CFTR gene, on hu chloride ion concentrat cystic fibrosis. How ma In G1 of the cell cycle In…

A: Phase Number of gene/chromosomes G1 phase of cell cycle- 2 copy G2 phase of cell cycle…

Q: Which one of the following statements about the propagation of the action potential is incorrect? O…

A: The action potential is any shift in the membrane potential due to an increase or decrease of…

Q: Which are true regarding tick-borne bacterial diseases? Select all that apply. - One example is the…

A: Tick borne diseases, that affect the human and other animals, are caused by pathogens transmitted…

Q: Which are phagocytes in liver ? (A) Kupffer cells (B) Aciner cells (C) Diter cells (D) Hensen's…

A: Introduction - Neutrophils, macrophages, and dendritic cells (DCs) are phagocytes with the ability…

Q: Why do many biologists classify red algae and green algae with land plants?

A: Red algae are also known as Rhodophyta are algae species that are mostly found in freshwater and one…

Q: Why is the nickname "dark reactions" not entirely correct for the chemical stage of photosynthesis?

A: Introduction - 6CO2 + 6H2O = C6H12O6 + 6O2 is a typical representation of photosynthesis. This…

Q: Explain the process of mRNA to DNA translation.

A: Translation is the process of decoding the mRNA and building a polypeptide chain by the information…

Q: Invasive species fishzilla How is it controlled?

A: Introduction Invasive species:- It is an organism that causes ecological or economic harm…

Q: Why is antibiotic resistance a problem and how can antibiotic resistance be prevented? (List the 7…

A: Antibiotic resistance Microorganisms that are not inhibited by usually achievable systemic…

Q: Explain the structure of the Ecosystem with a flowchart.

A: Species diversity is the variation in the species and all these species present in the large number…

Q: What are the long term effects of the continued use of the baygon insecticide to the members of the…

A: To explain: To explain the long-term effects of the continued use of the baygon insecticide in…

Q: During media preparation, you observed that the agar medium did not solidify after sterilization…

A: Nutrient Agar Medium is the artificial media which is used to grow microbes. It provides essential…

Q: Which group of bacteria contains the gram-positive, anaerobic bacterium that causes botulism? (a)…

A: Introduction :- Bacteria having thick cell walls are known as Gram-positive bacteria. These…

Q: To determine: The re

A: Stomata- These are the minute pores  surrounded by a pair of guard cell. These are also know as…

Q: Teratology is the study of exogenous chemical compounds (teratogens) that have the capacity to cause…

A: Teratogens are chemicals or physical agents taken during the pregnancy that harms the growth and…

Q: From the following list, which group  has many members with woody, perennial stems that show annual…

A: Equistem is basically the only genus left of subclass equisetidae. Also this is referred as living…

Q: Mendel’s observation that two different traits could be inherited independently of each other can be…

A: Genes on distinct chromosomes will be transmitted separately. When Mendel mated peas with many…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Name the three divisions (parts of the ear).

A: We will answer the first question as exact one question is not specified. Please send back the…

Q: Some materials, such as metal bone pins and plastic heart valves, can be implanted into the body…

A: Introduction Immune system:- It is a complex network of cells, tissues, organs, and the substances…

Q: The profile includes 4 STR loci. (D8S1179, D21S11, D7S820, CSF1PO) At how many of these is the…

A: Short Tandem Repeat Analysis STR analysis is a molecular technique by which short tandem repeats…

Q: In ethology, what are the cost and benefits of Group living?

A: Answer

Q: Pick one scientific conclusion that is put forth in this chapter that is based on both types of…

A: A scientific report typically depicts the results of scientific research in an experiment or either…

Q: of Traits and Species Rhesus Snapping Kangaroo Lamprey Bullfrog Human Tuna Monkey Turtle Dorsal…

A: Cladogram A cladogram is the phylogenetic tree representation that depicts the evolutionary…

Q: Robert Koch (a) proposed a set of guidelines to demonstrate that a specific pathogen causes specific…

A: Microorganisms are small living organisms some of which are pathogenic and cause diseases.

Q: What are the complections Of tooth extraction?

A: Introduction The removal of a tooth is known as tooth extraction. "An ideal tooth extraction is…

Q: Hardy-Weinberg principle

A: Definition: Hardy-Weinberg law of genetic equilibrium is that both gene frequencies and genotype…

Q: __________ are composed of a single linear (unbranching) chain of covalently bound amino acids.…

A: Amino acids are known as the building blocks of protein. These are organic compounds mainly composed…

Q: The giant axon of the squid (Figure Q11–3) occu-pies a unique position in the history of our…

A: The Nernst equation for univalent ions at 20 degree celsius is : V=58mV x log c0/ci  in which c0 is…

Q: The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C)…

A: Introduction - Humans have a "giant roundworm" called Ascaris lumbricoides, which can grow to be 35…

Q: (a) Which would be easier to prepare bacterial smear from, liquid or solid culture? Why? (b) Aside…

A: Introduction A bacterial smear is a small layer of bacteria that has been stained on a slide. A…

Q: What term describes the substance that is bound by an enzyme and converted to product? O a. Coenzyme…

A: Enzymes are proteinaceous substances that enhances the rate of metabolic reactions in our body.…

Q: What is the ploidy of two daughters of a dividing cell of a hornwort’s gametophyte?   Select one:…

A: The hornwort belongs to bryophyta. The root, stem and leaves like structure are present in the…

Q: Analyze the graphs below. Which growth model (exponential or logis- tic) would apply to a population…

A: Population growth  Population growth can be defined as the increase in the number of organisms in a…

Q: In a screening test for Chlamydia, the sensitivity is 83% and specificity is 50%.  A total of 800…

A: ANSWER;- The following table from the given information:     Truth         Disease Not Disease…

Q: DATAAND RESULTS: A. Description and source of isolates Nudeic Acid Source Description BANANA DNA…

A: All living things, including bananas and humans, pass on information from generation to generation…

Q: What factors influence the choice of a horse breed to buy? Draw a sketch of a horse and show the…

A: Light horse The light horse is the breed of horse that has more action and speed rather than other…