Protien searches are usually more informative than DNA searches. Perform a BLASTP search using RBP4 (NP_006735), restricting the output to Arthpoda (insects). How many database matches have an E-value less than 1.0 in each search ?
Q: Select three from the pictures below and discuss their uses in studying Biology.
A: Biology is a vast subject consisting of a great varieties of organisms and several techniques are…
Q: ustrate how two SMC proteins form a V-shape heterodimer.
A: SMC proteins stand for structural maintenance of chromosomes protein. These are the large family of…
Q: Objective lens X has a limit of resolution equal to 0.2 mm while objective lens Y has 30 µm. a.…
A: * object lens is the optical element which gathers light from object and focuses light rays to…
Q: Explain what eukaryotes are.
A: Answer
Q: What slide preparation technique should you use for the following goals?
A: Slide preparation begins with the fixation of your tissue specimen.
Q: Which of the following statement/s is/are true about gram positive bacteria Cell wall has thick…
A: On the basis of the structure, bacteria can be classified into two main types when they are gram…
Q: Define decomposition and describe the processes and products of decomposition.
A: Inorganic decomposition is the breakdown of complex organic matter or biomass from the bodies of…
Q: Objective lens A has a limit of resolution equal to 0.2 mm while objective lens B has 30 μm. a.…
A:
Q: Which of these is not part of transcription events Polymerase Primer Promoter Sigma factor Uracil
A: The transcription is the process by which RNA is produced from the DNA template. It is the first…
Q: Can you think of a situation where we deliberately want to make a species extinct? How would you…
A: Introduction A species is often defined as a group of animals, plants, or other living things that…
Q: Give a brief account of viruses with respect to their structure and nature of genetic material. Also…
A: Viruses are sub-microscopic infectious agents that can infect and destroy all living organisms on…
Q: Levels of Organization 1. Molecular Level 2. Cellular Level 3. Tissue Level 4. Organ Level 5. Organ…
A: Level or organization shows how the organism are organized into various levels. The very basic level…
Q: The binding of a signaling molecule to its receptor will trigger a series of chemical reactions…
A: The cell in our body has various receptors on the surface of its cell membrane. These receptors can…
Q: 1) Explain why the intersex condition supports the idea that sex and gender are non-binary and that…
A: Sex is usually categorized as female or male but there is variation in the biological attributes…
Q: 9. The pituitary gland releases follicle stimulating hormone (FSH). This hormone stimulates the…
A: The menstrual cycle is the shedding of unfertilized eggs and it begins on the first day of the…
Q: Why are there so many species in the tropical rainforest?
A: Biome is a spot that exhibit a particular weather and hold community of various plants as well as…
Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…
A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…
Q: Why are planktons important in the food chain?
A: Answer
Q: A site of communication between neurons is called a _________ 2. Where is the cerebral spinal fluid…
A: Neurons are also known as fundamental unit of brain and nervous system. The main function is to…
Q: Hydrolytic reaction do not always require the presence of water.
A: The word hydrolytic relates to the other word hydrolysis which means the breakdown process where…
Q: What might be a reason why a Buruli ulcer is initially painless?
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: What is Menopause?
A: Introduction In this question we will discuss about the Menopause.
Q: Discuss the mechanism of action of the enzyme chymotrypsin.
A: Chymotrypsin is a protease enzyme that digests the proteins cleaves the carbonyl side of peptide…
Q: Ana was tasked to measure the actual magnification of her specimen mounted on a slide without…
A: A light microscope or optical microscope is used to study a thin section of a rock. The section is…
Q: Describe the cell below in terms of structure and shape.
A: Lymphocytes are leukocytes that broaden from the common lymphoid progenitor. Although they typically…
Q: Identification
A: The action of regulating salt and water balance (osmotic equilibrium) through barriers in the body…
Q: Many enzymes obey simple Michaelis–Mentenkinetics, which are summarized by the equationrate = Vmax…
A: Michaelis-Menton kinetics is an equation that describes the rate of enzymatic reactions by relating…
Q: A gene is inherited as a X-linked recessive trait. A hemizgous father that has the recessive allele…
A: Genetic problems related with mutations in genes present on the X chromosome can be referred to as…
Q: Bacterial generation times for four different bacterial species were calculated in the media listed…
A: The time it takes for a population of bacteria to double in size is known as generation time. The…
Q: Can you think of a situation where we deliberately want to make a species extinct? How would you…
A: Extinction is the death of a type of organism or a group of organisms, most commonly a species.…
Q: Communications between cells is facilitated by the presence of
A: There are many cells in our body. Each cell needs to communicate with the other. This means the…
Q: How can change in natural resources ripple through asociety?
A: Natural resources are a base for existence of all the living organisms. If natural resources are…
Q: Which of the following part of the human brain has a center for controlling breathing? a) Medulla…
A: Introduction - The brain is a complicated organ that regulates our body's thought, memory, emotion,…
Q: Question 15: Define the following terms and give one example for each: (a) Commensalism (b)…
A: Commensalism: Commensalism is a type of interaction between two species in which one species…
Q: A key result of the pandemic has been the increased scrutiny of scientific research by a broader…
A: Introduction - Despite our public health response to the pandemic's shortcomings, the biomedical…
Q: Substances that contain both hydrophobic and hydrophilic regions are referred to as -__ molecules.
A: On both the inside and outside of the cell, the hydrophilic areas of phospholipids form hydrogen…
Q: (c) Discuss the mechanism of action of the enzyme chymotrypsin.
A: Chymotrypsin is an enzyme used by the digestive system to breakdown the component into smaller…
Q: Describe the structural adaptations that primates have for life in treetops.
A: Any mammal belonging to the primate family, which comprises lemurs, lorises, tapir, apes, gorillas,…
Q: Choose correct answers | Eastern Spruce Budworm (Choristoneura fumiferana) exclusively feeds on…
A: ANSWER) (a) Eastern Spruce Budworm exclusively feeds on spruce. Spruce budworm feeds on the white…
Q: Most living organisms cannot survive at temperature above 45°C°. How are some microbes able to live…
A: Various bacteria have proteins which denature with increasing temperature and coagulate due to which…
Q: BASIC BIOLOGY Funnel Volumetric Flask Graduated Cylinder Beaker Balance
A: 1. Human skeleton model:- These are the primary teaching tools used to teach students and patients,…
Q: 3. You eat a hamburger that you don't really need. The polysaccharides, fats, and lipids in the…
A: Many foods contain high amount of fat and carbohydrates which are broken down in our body into…
Q: What are some biological examples in which lysosomic enzymes play a fundamental role?
A: A digesting enzyme-containing lysosome is a membrane-bound cell organelle. Lysosomes play a role in…
Q: 2. You measure the cross sectional area of the quadriceps of 40 diff gazelle species. How should…
A: While referring to muscles Isometry means iso-same metry-length When proportional relationships are…
Q: True or False.
A: A membrane protein that is stably connected to the cell membranes is known as an integral membrane…
Q: TEXT ANSWER Answer the following three questions based on the diagram below. 1. Which of the…
A: There are two types of organisms based on their types of cells, based on their structure and…
Q: Which uses of animals, if any, are morally permissible, and which are morally wrong?
A: Some animals are friendly and don't harm us while some are wild and don't like to interact with…
Q: Explain the pollination occurring in the chasmogamous flowers.
A: All of the chasmogamous flowers are open and ready for pollination, with their anthers and stigmas…
Q: Glucose is an isomer of fructose only galactose only neither galactose nor fructose invert sugar…
A: Biological macromolecules are the molecule that are needed in enough amount for our body and…
Q: Sawfly larvae differ from Lepidoptera caterpillars | by having more prolegs. | by having…
A: Sawfly larvae ( belonging to order Hymenoptera) are immature stages of wasps or bees that have…
Step by step
Solved in 2 steps
- The photograph provided is of a 1 μg of 2-log ladder indicating the molecular size in kilobases (Kb) and amount of DNA per band in ng. Estimate the concentration of your PCR product (amplicon) in ng/μL by visual comparison. The expected size of your amplicon is about 600-bp (0.6 kb). ____μg/μL?which substitution matrix would you choose for a BLASTP search? justify your choice.Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
- The photograph provided is of a 1 μg of 2-log ladder indicating the molecularsize in kilobases (Kb) and amount of DNA per band in ng. Estimate the concentration of your PCR product (amplicon) in ng/μL byvisual comparison. ____μg/μL?t (5 a 1 dao) - Google Chrome edu.om/mod/quiz/attempt.php?attempt=2334320&cmid=1127808 SQU E-LEARNING SYSTEM (ACAI الوقت المتبقي 0.175mm .e O In the DNA extraction experiment, the separation of DNA from its packaging protein can be achieved by the addition of Detergent aO 1.00 Salt b O هذا السؤال Ethyl alcohol cO Papain powder .d O Cold water Le O In paramecium, osmoregulation occurs through 3 Activate Windowssk Macronucleus Goaotings to acttivate do nere to search 6. 70°F Mostly sunny 9:05 ENG 12/18 f2 O f3 O f4 O f6 O f8 end f7 0 F10 insert f9 D F12 T num IA break @ %24 & 8 2 3 r 4 5 6 7 8 A 9 9 R Y ! U S F G J K +|| 回 Q 以 4Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the original DNA sample used for sequencing? ddATP ddGTP ddCTP ddTTP - GGTTACC B CCATTGG CCAATGG GGTAACC | | | |
- This BLAST program performs the greatest number of searches for the same query sequence and database because of the greatest number of the reading frame translations. TBLASTX BLASTX BLASTN BLASTP PSI BLASTAlign two sequences: horizontal – GGAATGG, vertical – ATG, m=1, mm = 0, g=-1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). 0000 Align and score 4 optimal alignments here. the first line, v sequence in the second line and Each alignment should have h sequence individual scores for each alignment position in the third line.Visually compare the intensity of your team’s Plant-DNA sample with the intensity of the 3 kb band on the DNA ladder (see figure posted below). For example, if your Plant- DNA sample closely matches the 3 Kb band, this represents approximately 125 ng of total DNA. Divide the approximate mass (ng) of DNA in your sample by the volume loaded in the gel minus the loading dye added (i.e., 12 – 2 = 10 μL, since you loaded 12 μL from a 24 μL sample that contained 20 μL DNA prep + 4 μL loading dye. What is the DNA concentration of your sample? ______ng/μL
- Give only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?Approximately how large is the Escherichia coli genome in basepairs? How many genes does it contain?