Protein structure is central to our understanding biological systems. The tubular proteins that make up the cytoskeleton of the Amoeba are an example of complex Protein structure. Consider the following for the Amoeba and how it reacts to the outside world. Name the four levels of protein structure: How are these structural characteristics developed in the Endomembrane system of an Amoeba cell. Reminder, the endomembrane system includes the nucleus. How do the levels of protein structure explain the movement of the amoeba toward a stimulus.

Q: What can lead to mTOR inhil AKT OTSC1/2 active ☐ Exercise

A: Intracellular signaling happens between cells in different ways. Ligands that are hydrophilic in…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: For #74 and # 75, convert the DNA sequence into mRNA, and then the mRNA into protein (amino acids).

A: DNA and RNA are the two forms of genetic material, found in most living organisms. DNA is…

Q: What is the purpose of the confirmed test in an experiment designed to test for coliform bacteria?

A: Coliform bacteria are either nonmotile or motile, Gram Negative, bacilli bacteria. These are found…

Q: You have two E. coli cultures. One culture is a wild-type culture, and the other contains the lacOc…

A: Escherichia coli (E. coli) is a type of bacteria that is commonly found in the lower intestine of…

Q: Drugs and other medecine uses the concept of signaling. Cite some drugs how they mimic natural…

A: Many drugs mimic cell signalling molecules thereby stimulating cell function and compensate for…

Q: transport substances through the blood

A: Question : Which is not a function of a protein.   Answer: Transport substances through the blood.…

Q: You are a bacterium which entered the skin through a small cut. Which innate immune defenses might…

A: The instance has been provided here that a bacterium enters the skin through a small cut. Now, both…

Q: O Cats O Dogs O Elephants O Humans O Spiders (like Charlotte in Charlotte's Web)

A: Semelparity is a type of reproductive technique. It is opposite of iteroparity.

Q: Correctly label the following parts of the brainstem. Inferior cerebellar peduncle Midbrain Medulla…

A: The bottom part of the brain that connects the brain to the spinal cord is called the brainstem. It…

Q: Next you take measurements of different long bones to estimate stature. Humerus length = 30.04 cm…

A: Given that: Humerus length = 30.04 cm Femur length = 42.5 cm Tibia length 33.88 cm = Using humerus…

Q: Label the chambers and valves seen in an anterior view of the heart.

A: The correctly labelled diagram is shown in the step 2.

Q: The phase of the cell cycle in which cells perform thier cellular jobs is A) mitosis B) the G2 phase…

A: The sequence of activities that occur in a cell that leads to the replication of DNA and cell…

Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.

A: Introduction: Uterus Also called womb is an important organ of female reproductive system.its main…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…

A: Annotating a genome involves finding functional components throughout its sequence in order to give…

Q: What are the risks and protocols for testing growth of bacteria

A: Please follow steps 2 & 3 for detailed explanation.

Q: GCTA A AAG GCG

A: Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed…

Q: How do various criteria influence the choice of a given testing instrument? When choosing an…

A: Introduction:- Instruments are used to perform various tests, practicals and experimentations in…

Q: Monotremes all have what unifying feature? Arthropod-like pincers Placenta Ventral pouch Ability to…

A: Mammals belonging to the order Monotremata are known as monotremes. The Monotremata are the oldest…

Q: The Amoeba, the paramecium, and the euglena ( These are unicellular Protozoans) produce electrical…

A: Protozoans are  unicellular eukaryotes belonging to the kingdom protista. The structure of…

Q: Extranuclear inheritance can involve genes that are present in:     ribosomes   mitochondria…

A: Extra nuclear inheritance is also known as cytoplasmic inheritance. Extra nuclear inheritance is…

Q: Micropropagation, somatic embryogenesis, and organogenesis are three major in vitro plant…

A: Introduction:- Plant regeneration is defined as the generation of whole plant from a single cell or…

Q: What would happen in the directionality of that activity were reversed? Would proofreading work? If…

A: Despite the remarkable accuracy of DNA replication, errors can occasionally happen, such as when a…

Q: Figure 1. Maximum Likelihood Tree (branch style: traditional-straight) of Sardinella species…

A: The phylogenetic tree is a tree diagram showing the evolutionary relationships of organisms, how…

Q: STRETCH BAND LATERAL RAISES Bones Muscles Joint type(s) Movement(s) Name an activity you could do in…

A: Your breathing and heart rate will increase during endurance or aerobic exercises. They enhance your…

Q: A unique identifier of a sequence deposited in GenBank. OE-value O Voucher number Accession number…

A: What is the Genebank database? GenBank is a database that contains publicly available nucleotide…

Q: What is the distance between the f and h genes in cM

A: When dealing with such issues, it is crucial to first ascertain the genotypes of the parents. The…

Q: Lophotrochozoans add to their skeletal elements in abrupt rapid gradual invasive increments.

A: Introduction:- Animals are classified into different groups on the basis of various features and…

Q: Anthropology Describe and define anthropology and what makes it unique as a discipline

A: Introduction: Anthropology is the study of what makes us human i.e. systemic study of humanity, with…

Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…

A: The environmental DNA methodology provides a number of benefits over conventional surveying…

Q: At which stage of viral infection did these mutations most likely occur?   a.) Attachment b.) Entry…

A: Virus is an intracellular obligate infective agent that mainly consists of nucleic acid molecule…

Q: (a) Shown below is a schematic of the resulting engineered DNA segment in the plasmid. Fill in the…

A: Lac operon  It refers to an operon which are the group of genes with a single promoter - transcribed…

Q: Which of the following could not be used a a host cell receptor for viral entry?   a.) LPS on…

A: What is a host cell receptor for viral entry? Each host cell carries specific biomolecules, known as…

Q: You are tracing the inheritance of petal color in tropical sandflowers. You suspect that the…

A: In this test, we have 1204 white petal flowers, 296 orange petal flowers and 101 yellow petal…

Q: Correctly label the following functional regions of the cerebral cortex.

A: The correct labelling of the functional regions of brain is given in step 2.

Q: Based on the change to the nucleóti How did this mutation change the amino acid sequence of the…

A: A mutation is the term that describes change seen in the sequence of nucleotides that may…

Q: Define what a meningitis is and what tissue(s) are affected by it. Describe four causes of…

A: Despite advances in diagnosis, therapy, and vaccine, there were 8.7 million meningitis cases…

Q: Distinguish between skeletal, smooth, and cardiac muscle in terms of location and whether they have…

A: Introduction:- A tissue is defined as the group of cells that have similiar structure and functions…

Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…

A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.

Q: 4. What is meant by the description “antiparallel” regarding DNA strands? A. The 5' to 3' direction…

A: The DNA ( deoxyribonucleic acid) is the genetic material present in the nucleus. It have a double…

Q: 8 24 100 -Sardinella fimbriata - Sardinella albella -Sardinella tawilis -Sardinella gibbosa -…

A: Sardinella is a genus of fish belonging to the family Clupeidae that is found in the Atlantic,…

Q: Below is a table of allele frequencies. Locus 1 Freq(116) = 0.3 Freq(120) = 0.4 Freq(124) = 0.3…

A: Gene frequency is the proportion of a specific gene or allele that is repeated over time in a given…

Q: When will arm span and knee height be used? Are there any limitations on using these two methods?

A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…

Q: The process by which haploid cells are produced from diploid cells is called A( sexual reproduction.…

A: The DNA handed down from parents to children leads them to look alike. Reproduction necessitates DNA…

Q: 4. The organism circled at the base of a phylogenetic tree is A نام B C the simplest organisms among…

A: Introduction - Phylogeny - is the evolution of a genetically related group of organisms. a study of…

Q: Urianalysis- Need help understanding what is happening?

A: Question : Urianalysis - Need help understanding what is happening ?  Answer : Urianalysis is the…

Q: Horsetails are more closely related to angiosperms than they are to lycophytes.

A: introduction Angiosperms, are called as flowering plants they contains seeds enclosed within their…

Q: In Deuterostomes, nutrient molecules (monomers) are taken in to the space between the endoderm and…

A: Option (a) is incorrect because, in Deuterostomes, nutrient molecules (monomers) are taken up into…

Q: Use arrows to identify the following  - lingual epithelium - taste buds - furrow - secretory acini…

A: The mouth is the location of the salivary glands. Wide salivary glands come in three pairs. Parotid…

Q: A blood sample is drawn in NaCitrate. The platelet count on an automated instrument is 305,000/UL.…

A: A platelet count from blood drawn into a sodium citrate tube is multiplied by 1.1 to account for the…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.