Q: How do the number of fatalities related to heat waves compare to the number of deaths caused by…
A: A heatwave is a period of extreme heat accompanied by high humidity, especially in countries with a…
Q: The kidney is a target of several complicated pathways, but the effects can be summarized as the…
A: Introduction: Two bean-shaped organs, the kidneys are each roughly the size of a fist. One is on…
Q: Which of the following pairs correctly describes an example of antagonistic hormones that regulate…
A: Introduction The institution of glands that secrete chemical currier (hormones) is the endocrine…
Q: Why is the worldwide variation of prostate cancer incidence important?
A: Cancer is the state of uncontrolled cell division caused by a failure of control over the process.…
Q: The electron shells in an atom of silicon (atomic symbol Si) each
A:
Q: Which of the following is true about innate immune system? Check all that apply. PAMPs recognize…
A: Introduction Immunity is an ability of an organism to fight against a particular infection. There…
Q: Why do individuals with cystic fibrosis have pancreatic insufficiency?
A: Cystic fibrosis is caused by the a defect in the CFTR gene. This mutation in the gene causes cells…
Q: What is the map distance between the two rapid lysis mutations re and rf given the data below? 2…
A: Hint: Always less numbered progeny becomes recombinants. In the question given that, re- rf- X r+…
Q: What is the function of hepatocytes?
A: Introduction The liver is the largest gland in the body and plays various important roles in human…
Q: Survival Serpentine seeds Serpentine soil Sandstone seeds Sancstone soil Explain why you cannot…
A: Flower It is the reproductive organ of an angiospermic plant.
Q: Which of the following accurately represents proper genotypes for a dihybrid cross? Group of answer…
A: These options represent different types of crosses. In genetics on the basis of the characters or…
Q: Which of the following organism classification is based on free energy sources? A. lithotrophs B.…
A: Introduction All living organisms require energy for their metabolic process. Some organisms (green…
Q: In fruit flies, yellow body is a sex linked recessive allele. The dominant allele is dark bodied. If…
A: A bleeding ailment called haemophilia causes blood to not clot normally. Blood contains a variety of…
Q: 16 Which of the following correctly identifies a part of the human ear and its function? A. B. C. D…
A: Introduction : The cochlea is a long, coiled outgrowth of sacculus. It is the primary organ of…
Q: Name the seven parts that is responsible for the Breathing Process . Arrange them in order from…
A: Breathing It is defined as the process of facilitating gas exchange. It brings oxygen gas into the…
Q: is a substance secreted by cells in the lungs that reduces surface tension.
A: Introduction :- The lungs are two air-filled, spongy organs that are situated on either side of the…
Q: A wound is swabbed and the swab is placed at 4°C after collection to stop bacterial growth until…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: may u break it down a little more please
A: Integumentary system : Integuments are the largest system of the body. It includes skin and its…
Q: In fruit flies, yellow body is a sex linked recessive allele. The dominant allele is dark bodied. If…
A: This is the chart showing genotype as well as phenotype of the parent fruit flies. Q1. Now with…
Q: What are the three phases of hepatitis viral infection?
A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…
Q: Label name only
A: We know that Teeth help us to chew food that would be large enough to swallow. Teeth also help us to…
Q: The study of tissues is called cytology
A: Tissue is defined as group of cells that possess a similar structure and perform a specific…
Q: Which statement best describes how diving mammals are different than mammals that are not adapted…
A: So, this question is asking about feature which causes adaptation of diving mammals in water.…
Q: The oxygen liberated into the air for all life to use originates from molecules of Select one: a.…
A: Plants and other living things employ a process called photosynthesis to transform light energy into…
Q: Which of these discoveries were used by paleontologists to conclude that some hominins—Homo erectus,…
A: The species H. erectus is extremely diverse, which is not surprising given its long existence and…
Q: Why is a genetic predisposition suggested for testicular cancer?
A: Testicular cancer is hereditary. It passes from parent to offspring. Many genes alteration are…
Q: n your own words, explain the factors that lead to the Phenotypic variation andits importance to…
A: Evolution is a change in the frequency of alleles in a population over time. These alleles are the…
Q: Select one: a. glucose.
A: Respiration is an essential chemical activity carried out by all living creatures, including plants,…
Q: T5
A: The skin is the largest organ in the human body that forms a barrier by covering the body. It is the…
Q: TRUE OR FALSE: • Digestive secretions from the ● small intestine complete the digestion of…
A: Introduction Digestion is a process in which the food that we consume moves through the digestive…
Q: A close friend has joined a clinical trial. When you ask her about the types of treatment she might…
A: Introduction :- The purpose of epidemiologists is to use their findings to control diseases or other…
Q: What steps are necessary and unnecessary for non-protein coding genes?
A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…
Q: (1) The process responsible for absorption of water by root hair of plants is : a. Osmosis b. Active…
A:
Q: If you needed blood and the doctor told you, "Hey, you're lucky. You can take any ol' type of…
A: The blood cells of every different individual have a unique set of antigens present in the cell…
Q: 2 1 Ⓒ Giovanni Perez 3 4 SECTION
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Genotype frequencies from two diploid populations are estimated from a genetic marker with two…
A: Genotype frequency refers to the frequency or percentage of a particular genotype in a given…
Q: Glycolysis, which can occur in all living cells, correctly occurs in the cell structure _____, and…
A: Glycolysis is also known as EMP pathway (Embden - Meyerhof Pathway). It is a universal process. It…
Q: Describe the settings in which the reversed process of proliferation and differentiation is…
A: Cell proliferation can be described as a process of exponential growth and division of cells for…
Q: What step in the scientific method follows experimentation?
A: Introduction The scientific method of research is a process that involves various steps of…
Q: What do you call a sample that goes through all the steps of an experiment but is not exposed to the…
A: A hypothesis made cannot be necessarily right. Instead it is a best guess. however scientists…
Q: What is adaptive radiation? Explain it with the example of Darwin's finches.
A: Introduction Evolution is the gradual change in the inherited traits of biological populations over…
Q: M09. Answer correctly. Else
A: We know that Gametogenesis is the process by which gametes are produced. In humans, sperm is the…
Q: The maximum photosynthetic rate of a sun leaf is higher or lower than a shade leaf? Higher No answer…
A: Photosynthesis is the conversion of light energy by phototrophs into chemical energy, which is then…
Q: A Senecio lautus population growing on a headland has a prostate form, growing low to the ground,…
A: A Senecio lautus is a flowering plant species in the daisy family. The two main populations of this…
Q: Other than bacteria list the other 6 types of Microorganisms listed in your textbook.
A: Microorganisms are defined as the organism that can very smaller in size that they cannot be seen…
Q: In Coleus , the somatic cells are diploid with 24 chromosomes. How many of each of the following is…
A: Mitosis and meiosis are the types of cell division that take place in living organisms. Mitosis is…
Q: C- Find the vital capacity for a person with a total lung capacity of 7 L and a residual volume of…
A: Vital capacity can be defined as volume of air exhaled after maximal inhalation. While Total lung…
Q: Julie (a female) has hemophilia. Based on this information, what can we say about the genotypes of…
A: Introduction X-linked diseases are those that occur due to the presence of abnormal/ diseased…
Q: Choose the incorrect statement about skeletal muscle. Question 3 options: Skeletal muscle is…
A: Skeletal muscles account for 30 to 40% of total body mass. They are the muscles that connect to your…
Q: How has MRSA changed musculoskeletal infections in children?
A: MRSA-related musculoskeletal infections are frequent in osteomyelitis and septic arthritis.…
1. What features of a protein-coding gene might be found in a non-coding gene?
2. What features are unnecessary in a non-coding gene?
Step by step
Solved in 2 steps with 1 images
- Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letterb) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) 5'TATTATAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3'-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter (i) (ii) TSS (iii) Terminator Figure 2 Which DNA strand (the top or the bottom) is used by polymerase as a DNA template? List the mechanistic steps that can trigger the initiation of transcription by the Sigma Factor. What are the amino acids translated from the resulting mRNA? Indicate the amino (NH₂*) and carboxyl (COO) termini of the polypeptide chain.mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadpleb) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5'-TATTATAACGCATGAGGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5 Promoter ********* Terminator Figure 2 Based on the DNA sequence of terminator, draw the structure of the hairpin loop that will be formed during the end of transcription.Post-transcriptional Modification of Eukaryotic mRNAs What might be the advantages of capping, methylation, and polyadenylylation of eukaryotic mRNAs?
- The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGRAAGGCTCCTTTTGGAGCCTTTTTT-3' 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter Terminator Figure 2 Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop that will be formed during transcription. Illustrate how the hairpin loop structure initiates the termination of transcription.5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
- mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A