Q: how the sequential opening and closing of voltage-gated sodium and potassium channels leads to…
A: Answer: sequential opening and closing of voltage gated sodium potassium channels leads to…
Q: The primary structure of a protein is formed in the A) the RER, B) Golgi apparatus, C) nucleoid, D)…
A: Protein is a polymer of amino acids. The peptide bond is present between two amino acids.
Q: A gardener planted red flowering plants in a garden. He crossed the red flowers with white flowers,…
A: *Homozygous inheritance is the condition where an individual will inherit the same DNA sequence from…
Q: The site where a noncompetitive inhibitor binds to an enzyme is called: OActive site O Receptor site…
A: When an inhibitor binds to the enzyme in a location other than the active site, it is known as…
Q: Change in chromosome numbers will lead to abnormalities. Which of the following is a correct match…
A: Introduction A karyotype is a preparation of the entire set of metaphase chromosomes in the cells of…
Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…
A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…
Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
A: RNA- It stand for the ribonucleic acid. is a nucleic acid present in all living cells and in some…
Q: Evolution of what biological process is hypothesized to have been made possible by the appearance of…
A: Introduction :- Chlorophyll is a group of green pigments found in the mesosomes of cyanobacteria and…
Q: Is the ability to modify traits an organism carries a new technology? Explain
A: INTRODUCTION The technology that is used to modify the traits of an organism is recombinant DNA…
Q: having
A: Biomolecules are the molecules that are involved in the maintenance and metabolic processes of…
Q: Acclimatization is adaptations in a lab-controlled setting. True False
A: Acclimatization is the beneficial physiological adaptations that occur during repeated…
Q: D. After you have examined the inflorescence of several specimens, complete Table 4.1. Table 4.1…
A: Oryza sativa panicle The dominant accessions were found in three regions; early heading in North…
Q: List the four distinguishing chordate traits.
A: Chordate contains two classes of invertebrates and one class of vertebrate. Invertebrates include…
Q: urther discussion questions: a) What is the wavelength of UV light with maximal absorbance by…
A: Proteomics is a new field based on the human genome project. Proteomics is primarily concerned with…
Q: 2. An atrial septal defect is a birth defect in which there is an opening in the septum between the…
A: Introduction The cause of an atrioventricular septal defect is unknown. An atrial septal defect is a…
Q: Why is solely cutting calories not as efficient as cutting calories and exercise? O Reduced resting…
A: Diet and exercise are both important for optimal health. Achieving a calorie deficit through diet…
Q: Which of the following is not a sustainable fishing solution? O Limit the number of fish that can be…
A: Sustainable fishing is very important to continue fishing. Because it is essential to leave some…
Q: Describe some ways that crocodilians are similar to birds
A: Crocodilia are a small group of large, carnivorous aquatic animals that have remained essentially…
Q: List the anatomical pathway the water molecule takes from the left biceps femoris until it is…
A:
Q: Which tissue type or organ is correctly matched with its germ layer tissue? A) nervous–mesoderm B)…
A: Introduction :- The mesoderm is a germ layer that develops between the ectoderm, which produces skin…
Q: the diploid somatic nucleus of xenopus has 900 copies of rDNA and in the mature oocyte it could…
A: Transcription is a process in which DNA is converted to RNA.
Q: What is the relationship between evolution and natural selection?
A: Answer : Evolution is the new species or something new evolve in a species and natural selection is…
Q: determine if the species is regular/irregular Regular/Irregular Hydrangea macrophylla…
A: Introduction Regular flower:- When the floral parts of each whorl of a flower are similar in size…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: association of 2alpha and 2 beta chains to form adult hemoglobin identify which describes the…
A: Translation is process of conversion of RNA to protein.
Q: How many ATP molecules are required for the fixation of one CO2 molecule via the Calvin cycle to a…
A: Cellular respiration is a metabolic process in which glucose is consumed and ATP is liberated. It…
Q: The TATA-binding protein (TBP) is thought to be necessary for transcription in all eukaryotic cell…
A: The TATA-binding protein is a generic transcription factor that binds specifically to the TATA box…
Q: Think about Clostridium botulinum. Explain the terms below that describe this a. Gram-positive b.…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Describe how you would go about step-wise using the biotechnology available (RNA sequencing, PCR,…
A: The most efficient strategy for disease prevention and control is vaccination, which involves the…
Q: heterozygous mice for the Sd gene are shown to have relatively shorter or lack a tail true or false
A: Sd / wildtype = heterozygous = short tail Wild type/ wild type = homozygous = long tail Sd/Sd…
Q: When the concentration of the hormone insulin is too high for an extended period: O The number of…
A: Insulin is defined as a peptide hormone which is generated by pancreatic islets of Langerhans cells…
Q: What is sere?
A: Ecological succession: The mechanism whereby the mix of species and environment in a given area…
Q: Target cells are: O Cells that send the signal O Cells that receive and respond to the signal Cells…
A: Introduction cell signaling or cell communication is the ability of a cell to receive, process, and…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.
Q: Describe three drivers of mutualism breakdown. For these drivers of mutualism breakdown, in what…
A: Mutualism refers to a partnership in which both creatures get something from the other. In this…
Q: Polygenic Inheritance: Cat Coat Color Read about the inheritance of cat coat color In each cat…
A: Given: X Gene is affected by coat color. Allele X^b - black fur. Allele X^B - orange fur. If it is…
Q: Alternative splicing of the same pre-mRNA produces two isoforms.
A: 30) During RNA splicing , the introns are precisely excised and exons are ligated together. However…
Q: Explain the significance of step-wise release of energy in respiration
A: * Energy will be released in our body by means of metabolism and it's pathways. * In humans and…
Q: An experimental cell line expresses K+ inward rectifier channels, Na+ leak channels, K+ channels…
A: The α-1 adrenergic receptor is a type of receptor that is responsible for mediating the effects of…
Q: What are the structural components of a virus?
A: A virus is a non-cellular organism with an RNA or DNA genome encased in a virus-coded protein coat.…
Q: Which of the following statements BEST explains the relationship between the parts of genetic…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: Discuss the study of chemical hazards and their effects,including wildlife toxicology, epidemiology,…
A: Toxicants can be both organic and manmade, and there are hundreds of synthetic compounds in our…
Q: Three potential inhibitors for VEGF were discussed in the signal transduction simulation. Explain…
A: *VEGF also called as Vascular endothelial growth factor also called vascular permeability factor…
Q: 4 Describe the Fluid Mosaic Model of the plasma membrane.
A: Introduction :- S.J. Singer and Garth L. Nicolson proposed the fluid mosaic model. This model…
Q: Discuss the operation of Na+ - K+ pump in further detail (2 pages including a few figures, if…
A: * The sodium potassium pump can be found in many cell plasma membranes which can be Powered by ATP…
Q: If a cell is placed in a solution that has the same concentration of solutes as in its cytoplasm,…
A: When a cell is submerged in an isotonic solution, there is no net movement of water entering or out…
Q: Which of the following replication enzymes will most likely be involved in COVID19 RNA replication?…
A: Coronaviruses (CoVs) are the most common type of virus in the Nidovirales order, which comprises the…
Q: I. Individuals diagnosed with autism can have reduced expression of the oxytocin gene due to…
A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…
Q: Before a competition, a meal should be consumed that is high in... Water O Lipids O Carbohydrates O…
A: The purpose of the pre-competition meal is to calm an athlete's stomach by absorbing some of the…
Q: Construct a cladogram based on the following data. Mosses are plants with no vascular tissue.…
A: Land plants can be referred to as multicellular creatures that have a variety of properties that…
Can you help me answer this
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- (Ate domons Pemphy leAic Amplexes Kinedic Skul metarmorphoSiS perennibrenchiate Al4 RICAL SAmPhagous Embryonic diapause Hypodermic mprcgntmLabel A and B as the following: Egg/ Antheridia/ Archegonia/ ZygoteLabel the structures: Scolex, immature segment, mature segment, gravid segment, ova, cysticercus specie: Taenia solium attach labeled image. thank you
- Please hand draw Obelia medusa and label it with the following terms. Medusa, Gonad, Radial Canals, Note: please be sure to label the illustration with all of the terms provided.Please draw Tanea (Class Cestoda) and label its anatomy with the following terms listed below. Note: Terms to label drawing with. Scolex, Testes, Ductus Deferens, Ovary, Vagina, Genital Pore Please be sure to include all the terms given in your drawing labeled.Development Label the following embryo development stages and cells:zygote, blastocoel, embryoblasts, blastomeres, morula, biastocyst, zona pellucida, trophohlasts Zuna pelmicida Stage: 3 Zy90+€ trophoblest blastucuel empryoblost Stage: OORa Stage: blaşt oist How does the overall size of the early embryo compare with the size of the zygote? Explain. At which stage of development does the embryo implant in the uterus?
- What type of gastrulation is depicted from the diagram below? (A) Blastopore Blastopore 4A 4D 4c 4b AB 4D 4a 4C ImR Invagination Involution Ingression Delamination Epiboly None of the choices ImL ImR 4D ImL BlastoporeLear ing Tek #4: P!CTURE ANALYSIS: Classify the picture as positive or negative feedback and explain how ieedback mechanism works in it. and explai how ieedback mechanism works in . POSITIVE/NEGATIVE FEEDBACI EXPLANATION FICTURE 1. Blood clotting Piatele Clot Fibrin Image Source: https://www.msdmanuals.com/- Imedia/manual/homeimages/hem blood clots pluggina.aif?thn=0&sc_lan 9=en Blood sugar Low Biood Supar promnles renase of Glucagon Insulin Immelin L s BicHd Sugar High Blood Sugur Image Source: https://.pinima.com/originals/5e/54/8e/5e548eb7090eb9d9 ede35475a83e7147.ipg ert 3. Thermoregulation Bady tenyeraure decreases Buty toneraliO Increases コ heling (shivering increases fleproases Image Source: https://ib.bioninja.com.au/ Media/negative- feedback med.jpeg 51 2.Identify prefix, root word, and suffix of the following words: Chondrocyte gestation Prognosis Diagnosis Paranasal Biopsy Myeloma Lumbosacral chordoma Hemorrhage Intravascular Coagulation Chiropractic notochord Endoderm Mesoderm Ectoderm Dysfunction Symptomatic Hypoesthesia Anesthesia Gastrulation Neurolation Notogenesis Radiculopathy Asymptomatic
- Activity 1. Define each of the concepts below. Acrosome Amnion Blastocyst Blastula Chorion Cortical reaction Extraembryonic membranes Gastrulation Holoblastic Isolecithal Meroblastic Morula Placenta Radial cleavage Spiral cleavage Telolecithal Trophoblast Activity 2. Using the concepts from Activity 1, make mini-concept maps (two concepts connected by a relationship) by connecting each concept to at least one other.Label A-K as the following: -Anus -Stomach -Digestive Gland -Gonad -Ambulacral Ridge -Intestinal Cecum -Ampulla -Madreporite -Water Vascular System -Pyloric Duct -Tube FeetStorage of milk is found within the of the breast . Montgomery's tubercles Lactiferous ducts Myoepithelium Alveoli