![Computer Networking: A Top-Down Approach (7th Edition)](https://www.bartleby.com/isbn_cover_images/9780133594140/9780133594140_smallCoverImage.gif)
Computer Networking: A Top-Down Approach (7th Edition)
7th Edition
ISBN: 9780133594140
Author: James Kurose, Keith Ross
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
thumb_up100%
4act3 Please help me solve this python
![Activity #3:
Create a file named Lab4a_Act3.py for this activity. Please separate the various parts of your code with the
following comment to identifying the separate sections (copy/paste into your file with the appropriate letter).
########## Part A ##########
Part A: Inputting Boolean values from the keyboard
Write a simple code to take as input from the user Boolean values from the keyboard for variables a, b, and c.
The user should be able to enter a value indicating Boolean True and Boolean False from the keyboard and have
the code create a Boolean variable representing the user's input for use in Boolean expressions that appear later
in the code. You will need a simple code to make some decisions based on the values of these Boolean variables
to verify that your scheme works.
The user should enter True, T, or t for Boolean True. To indicate Boolean False, the user should enter
False, F, or f. Note: Numeric input is not permissible.
If this proves to be a bit of a challenge, review Lecture 3 slides covering Boolean conversions. You will need to
use your new-found knowledge of if-elif-else blocks to make this work as described.
Part B: Evaluating Booleans
Add to your program code that evaluates the following Boolean expressions using the variables a, b, and c from
Part A. The program should output the value True or False of the expression for the entered values. Use
Boolean expressions; do NOT use if-elif-else blocks.
1. a and b and c
2. a or b orc](https://content.bartleby.com/qna-images/question/b3bae496-b29b-443e-8307-d9fa541b6fb0/8d1c4535-ef2e-4f39-819c-3832a6125afe/ycl10k_thumbnail.png)
Transcribed Image Text:Activity #3:
Create a file named Lab4a_Act3.py for this activity. Please separate the various parts of your code with the
following comment to identifying the separate sections (copy/paste into your file with the appropriate letter).
########## Part A ##########
Part A: Inputting Boolean values from the keyboard
Write a simple code to take as input from the user Boolean values from the keyboard for variables a, b, and c.
The user should be able to enter a value indicating Boolean True and Boolean False from the keyboard and have
the code create a Boolean variable representing the user's input for use in Boolean expressions that appear later
in the code. You will need a simple code to make some decisions based on the values of these Boolean variables
to verify that your scheme works.
The user should enter True, T, or t for Boolean True. To indicate Boolean False, the user should enter
False, F, or f. Note: Numeric input is not permissible.
If this proves to be a bit of a challenge, review Lecture 3 slides covering Boolean conversions. You will need to
use your new-found knowledge of if-elif-else blocks to make this work as described.
Part B: Evaluating Booleans
Add to your program code that evaluates the following Boolean expressions using the variables a, b, and c from
Part A. The program should output the value True or False of the expression for the entered values. Use
Boolean expressions; do NOT use if-elif-else blocks.
1. a and b and c
2. a or b orc
Expert Solution
![Check Mark](/static/check-mark.png)
arrow_forward
Step 1
Required:
Required code with comments for explanation and screenshot of both code and output has been provided in the next step.
Step by stepSolved in 4 steps with 4 images
![Blurred answer](/static/blurred-answer.jpg)
Knowledge Booster
Similar questions
- Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…arrow_forwardCan you please advise me as to how you would structure the code? Regardsarrow_forwardPlot artificial intelligence Python You have to write codearrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Computer Networking: A Top-Down Approach (7th Edi...Computer EngineeringISBN:9780133594140Author:James Kurose, Keith RossPublisher:PEARSONComputer Organization and Design MIPS Edition, Fi...Computer EngineeringISBN:9780124077263Author:David A. Patterson, John L. HennessyPublisher:Elsevier ScienceNetwork+ Guide to Networks (MindTap Course List)Computer EngineeringISBN:9781337569330Author:Jill West, Tamara Dean, Jean AndrewsPublisher:Cengage Learning
- Concepts of Database ManagementComputer EngineeringISBN:9781337093422Author:Joy L. Starks, Philip J. Pratt, Mary Z. LastPublisher:Cengage LearningPrelude to ProgrammingComputer EngineeringISBN:9780133750423Author:VENIT, StewartPublisher:Pearson EducationSc Business Data Communications and Networking, T...Computer EngineeringISBN:9781119368830Author:FITZGERALDPublisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9780133594140/9780133594140_smallCoverImage.gif)
Computer Networking: A Top-Down Approach (7th Edi...
Computer Engineering
ISBN:9780133594140
Author:James Kurose, Keith Ross
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9780124077263/9780124077263_smallCoverImage.gif)
Computer Organization and Design MIPS Edition, Fi...
Computer Engineering
ISBN:9780124077263
Author:David A. Patterson, John L. Hennessy
Publisher:Elsevier Science
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337569330/9781337569330_smallCoverImage.gif)
Network+ Guide to Networks (MindTap Course List)
Computer Engineering
ISBN:9781337569330
Author:Jill West, Tamara Dean, Jean Andrews
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337093422/9781337093422_smallCoverImage.gif)
Concepts of Database Management
Computer Engineering
ISBN:9781337093422
Author:Joy L. Starks, Philip J. Pratt, Mary Z. Last
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780133750423/9780133750423_smallCoverImage.jpg)
Prelude to Programming
Computer Engineering
ISBN:9780133750423
Author:VENIT, Stewart
Publisher:Pearson Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9781119368830/9781119368830_smallCoverImage.gif)
Sc Business Data Communications and Networking, T...
Computer Engineering
ISBN:9781119368830
Author:FITZGERALD
Publisher:WILEY